The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ Q.Where, approximately, will the transcription start site be?

The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ Q.Where, approximately, will the transcription start site be?

Name: The following diagram represents a transcription unit in a hypothetica
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The following diagram represents a transcription unit in a hypothetical DNA molecule.5′ … TTGACA … TATAAT … 3′3′ … AACTGT … ATATTA … 5′Q.Where, approximately, will the transcription start site be?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
What polypeptide would be produced from the following strand of DNA? The first pair of nucleotides (bolded) contains the start point of transcription. Label the C-terminus and N-terminus ends of the polypeptide. 3’-ATGCCTACGGGTACGCCACTACTCCC-5’ 5’-TACCCATGCCCATGCGGTGATGAGGG-3’
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?
This diagram shows a double-stranded section of DNA. The arrow indicates location and strand of the transcription start site. The direction of transcription is also indicated. In which box would you find a 5’TATAA \3’ promoter sequence that would be used for initiating transcription at the start site shown? a) Box A b) Box B c) Box C d) Box D
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Mark the point at which transcription will terminate
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? Sigma Start codon Promoter Primer
Based on one strand of a certain segment of DNA with the sequence below, answer the following question: 3’-ATGGATCCCATC-5’ What must the primary amino acid sequence be (assuming that the above sequence does not require post-transcriptional modification)?
This is a double-stranded DNA sequence—with no introns—that codes for a small protein (this is a hypothetical example: real genes are much longer and have introns). Transcription begins at the Transcription Start Site, which is the G/C base pair indicated by “TSS” and gold shading. Transcription stops at the A/T base pair marked with the arrow. (shown in image 1) 1)Which strand is the template strand for transcription? a)top b) bottom 2)What elements allowed you to identify the template strand? (Select all that apply) a)An ATG toward the 5' end ("upstream"} from the TSS b)The template strand has the 3' end on the left side. c) An ATG toward the 3' ("downstream") from the TSS d) The template strand is "read" by the polymerase from its 3' to 5' end. 3)What is the sequence of the mRNA transcribed from this gene? a) 5’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA3’ b) 5’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU3’ c) 3’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA5’ d) 3’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU5’ 4) Write the…