The hypothetical mRNA sequence below contains the coding region for a short peptide. What consequence for this peptide does the substitution of the uracil at position 28 of the mRNA with guanine have? GGUUGAAUGGAACAACGCGUGCACCCUUAGAGGUAACCCUCC | G Group of answer choices No consequence, it is a silent mutation. It shortens the peptide by two amino acids. It destroys the start codon of the peptide coding region. It extends the peptide by two amino acid. It replaces one of the original amino acids of the protein with a different one.
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
The hypothetical mRNA sequence below contains the coding region for a short peptide. What consequence for this peptide does the substitution of the uracil at position 28 of the mRNA with guanine have?
GGUUGAAUGGAACAACGCGUGCACCCUUAGAGGUAACCCUCC
|
G
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
