The Muts proten slides along the DNA and finds a mismatch. The MutS/Mutl complex binds to MutH, which is alroady bound to a hamimethylated sequence. ČTAG Parontal - strand - MutH Mutl -Muts MutH makes a cut In the nonmethylated strand. Mutu (not shown) separates the DNA strands at the cloavago site, and an exonuclease (not shown) digests the nonmethylated strand until It passes the site where MutS is bound, removing the Incorract base. Incorrect base GA MutH cleavage site DNA polymerase fills in the vacant reglon. DNA ligase seals the end Themismatch has been repáred correctly.

Q: Assume that a poly(A) tract five base pairs long produces a 20° bend in aDNA strand. Calculate the…

A: When bending elements are repeated in phase with the helix turn (i.e., every 10 base pairs) as in

Q: If this is the original sequençe of a DNA strand: CCAGGTCCATGACTTAGC, how would you labeled the one…

A: It is an alteration in the nucleotide sequence of the genome of an organism.

Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…

A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…

Q: ЗА. This DNA after Bsal digestion, produces a DNA fragment with sticky ends as shown in the figure…

A: Introduction :- DNA strands are digested with the help of various restriction enzymes .Bsal is an…

Q: Single-stranded binding proteins (SSBPs) bind to single-stranded DNA at the replication fork and…

A: A pairs with T with2 hydrogen bonds and C pairs with G with 3 hydrogen bonds.

Q: Double-helical DNA has major and minor grooves because

A: The question is regarding DNA double helix structure. The structure of a DNA molecule is described…

Q: Each DNA sequence that can serve as an origin of replication is found to contain a binding site for…

A: On a chromosome or a plasmid, an origin of replication can be referred to as a stretch of DNA where…

Q: DNA polymerase IIl sometimes makes a mistake during replication and builds the wrong nucleotide into…

A: A mutation is a phenomenon in which the Deoxyribonucleic Acid (DNA) segments are inserted into or…

Q: The palm domain of a DNA polymerase O contains the catalytic site of the enzyme Ograbs the incoming…

A: The majority of organisms' genetic material, deoxy ribonucleic acid (DNA), contains nucleotide…

Q: ou are given a segment of DNA : 5’  - CATGTCAAC – 3’    What is the complimentary strand?

A: Adenine in DNA always pairs with Thymine and cytosine always pairs with Guanine and vice versa .…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: During retrotransposițion of a short interspersednuclear element (SINE), nicking the target site DNA…

A: A complete genetic material present in an organism is referred to as a genome. Deoxyribonucleic acid…

Q: The palm domain of a DNA polymerase contains the catalytic site of the enzy Ograbs the incoming…

A: Introduction Humans and nearly all other species carry their genetic information in DNA…

Q: If a piece of the template strand of DNA has the sequence 5’- ACG.ACC.GCC.GGT -3’ and it is…

A: Codon is a group of three bases in mRNA. Each codon specifies an amino acid.

Q: Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA…

A: Point mutation : It occurs as result of replacement of one nucleotide by other. point mutation bring…

Q: How does E. coli determine which nucleotide to "fix" in a base mismatch? The appropriate DNA repair…

A: MutS recruits MutL and two MutH proteins to the mismatch.

Q: A deamination occurs on the cytosine residue in the following DNA sequence. This cytosine residue…

A: Deamination is one of the common forms of "hydrolytic DNA damage" in living organisms. Deamination…

Q: /hich of the following statemer ue about DNA polymerase: DNA polymerase can synthesiz- MRNA in the…

A: DNA polymerase (DNAP) is an enzyme that makes new copies of DNA in the form of nucleic acid…

Q: Which of the following enzymes can recognize and remove a damaged DNA base to leave an apurinic or…

A: Genetic variation is very important for evolution, but genetic stability is crucial for survival…

Q: How would nucleotide excision repair be affected if one of the followingproteins was missing?…

A: The process of identification and correction of damaged DNA molecule by a cell which encodes its…

Q: single DNA molecule contains two specific target sites separated by an intervening sequence. If…

A: *Here A single DNA molecule contains two specific target sites and they are separated by an…

Q: This is the original strand of DNA: ATG AAG TTT GGC TAA Which option would represent a frameshift…

A: Mutations are any change in the nucleotide sequence in DNA or rna molecules.

Q: Segment of DNA SGCTAACCTGATCGCCGGTATT 3'CGATTGGACTAGCGGCCATAAS 3' 1. Transcribe and translate the…

A: The change in nucleotide is called a mutation. it could be a point mutation when one nucleotide is…

Q: Describe the genetic roles of DNA helicase and DNA polymerase. Contrast the function of DNA…

A: Helicases are enzymes that bind to nucleic acid or nucleic acid protein complexes and can even…

Q: The electrical current created during gel electrophoresis forces DNA to move from the negative end…

A: Answer.  DNA or Deoxyribonucleic acid is made up of nucleotides. A nucleotide contains a phosphate…

Q: Of adding lable sait Table salt dissociates into Na* and Cl" in water. The Na* binds to positively…

A: DNA extraction is the chemical method that is used to isolate or extract DNA from the nucleus and…

Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…

A: Mutations are DNA errors that occur during life. A mutation is defined as any alteration in the DNA…

Q: DNA pol III synthesizes the leading strand as a continuous strand. The lagging strands are…

A: DNA, deoxyribonucleic acid is a double helical molecule present in the cell which carries genetic…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: Bases pair up quickly on the leading strand, however, the bases have to be filled in backwards on…

A: BASIC INFORMATION  DNA it stands for deoxyribo nucleic acid.  it is the genetic material of all…

Q: For a double stranded coding region DNA transcribed from left to right and whose top strand is…

A: There are two strands of DNA. One strand goes from 5' to 3' and the other strand goes from 3' to 5'.…

Q: Work in a small group or alone to complete this exercise. In Lab 2, Exercise 8, you determined the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…

Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If…

A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…

Q: Using this strand of DNA (TACAACTGA), show what a substitution would look like”

A: Substitution is a type of genetic mutation in which there are three possibilities after the…

Q: Which of the three Mut proteins is responsible for ensuring that the mismatched base in the newly…

A: DNA replication is the process in which DNA molecules get duplicated. It includes initiation,…

Q: An investigator obtalns a bacterial temperature-sensitive mutation that affects a step in the…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: What is the name of this process? This process brpins at a site (where the Xxaren the DNA clled What…

A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…

Q: Which of the following is NOT a function of DNA polymerase III? Group of answer choices Exonuclease…

A: The main activity of DNA polymerase 3 is to add nucleotides to the short RNA primers. This is the…

Q: Which of the following statement(s) is/are false/incorrect? You may select multiple options, if…

A: Introduction :- A DNA polymerase is an enzyme that catalyzes the manufacture of DNA molecules from…

Q: The DNA polymerase I uses its to remove the RNA primers during DNA replication in E. coli cells.…

A: DNA synthesis is a semiconservative process in both eukaryotes and prokaryotes. This means that each…

Q: Select the statement(s) that accurately describe the function of DNA polymerase and the types of…

A: Mutation is a phenomenon that results in alteration of DNA sequences. This results in changes in the…

Q: The function of gamma (y) complex of DNA polymerase III is to Select one: O a. to unwind double…

A: DNA polymerase III falls in the category of an holoenzyme that has two core enzymes, a sliding clamp…

Q: If dhe sequence and directionality of one strand of DNA 1s 5-GCTAG-3', what is the sequence and…

A: DNA stands for deoxyribonucleic acid is composed of two polyneuclotide chains that could around each…

Q: Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in…

A: Inversions are half-circle rotations of a region of a single chromosome. It is important to remember…

Q: Formation of a recombinant DNA molecule. GAATTC GAATTC CTTAAG CTAAG double-stranded DNA CAATTO…

A: Ans : In the given diagram, 1 is representing the restriction sites.

Q: DnaA proteins bind to repeated binding sites on the DNA double helix, helping to recruit the…

A: Replication is the process by which a double-stranded DNA molecule is copied to produce two…

Q: Here is the sequence of a portion of one strand of DNA: 5'-GTCCTAACGACTGATCGT-3' a. What is the…

A: According to the central DNA is converted to RNA (transcription) and RNA to protein (translation).…

Q: A single (+) strand of DNA (base composition: A, 21%; G, 29%; C, 29%; T, 21%) is replicated by DNA…

A: DNA is the genetic material which stores all the biological information.  It helps transmitting…

Q: A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of…

A: A mutation is an abnormal change in DNA sequences that alters the protein product and is one of the…

Q: With respect to DNA binding motifs and their characteristics choose the correct answer O A. All DNA…

A: DNA-binding domains (DBD) are protein domains that can fold independently. They have at least one…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.