There are five spicule specimens, identify the specific type of spicule

Q: Species C: ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTA…

A: By submitting your query sequence to the chosen database, do a BLASTn search. By comparing your…

Q: What is the advantage in using LSTB in the presumptive test for the presence of coliforms?

A: LSTB has selective properties that favor the growth of coliform bacteria while inhibiting the growth…

Q: Scientists are experimenting with new technologies that could help people with missing limbs. In one…

A: The basic cerebral pathway from sensory stimuli to motor output in the example of a…

Q: draw the peptide structure n-GYSEDAK-c in low pH

A: Various amino acids are connected to each other by means of a peptide Bond. Amino acidds connect…

Q: The purple sulfur bacteria using PSII produce reducing power (i.e. NADH) during light reactions of…

A: Purple photosynthetic bacteria, are typical anoxygenic photosynthetic bacteria. These bacteria use…

Q: Exercise Lab 6: Photosynthesis & Cellular Respiration Diagrams Group Section_ Name Date Using your…

A: 1- The given diagram illustrates the process of phototosynthesis in two steps:a- Z-scheme/ non…

Q: How does the presence of a keystone species affect the stability and diversity of an ecosystem's…

A: The presence of a keystone species can have a significant impact on the stability and diversity of…

Q: Among the tetrapods, reptiles evolved a key adaptation that allowed them to become fully independent…

A: Evolution is the process of change over time in the inherited characteristics of a population of…

Q: Provide one plausible explanation that would account for what may have gone wrong resulting in the…

A: Transformation is a process in molecular biology where foreign DNA is introduced into a host…

Q: How does the biological process of emotions impact the overall functioning and adaptation of the…

A: The biological process of emotions plays a significant role in the overall functioning and…

Q: What can go wrong if a body system malfunctions. Describe your understanding of the concept, add…

A: The aberrant operation or disruption of a particular physiological system within the human body is…

Q: Test that Mode of Inheritance is Sex Linked Recessive for experiments at each of two research…

A: If the mode of inheritance is sex linked recessive as in the above question then female carrying the…

Q: Norepinephrine and epinephrine increase neuron activity in the brain. This is likely directly…

A: CNS Central nervous system is stimulated by two major neurotransmitters called norepinephrine &…

Q: How does alternative splicing and proteolytic cleavage affect protein pro/hormones of the same gene?

A: Alternative splicing and proteolytic cleavage are post-transcriptional and post-translational…

Q: Put the labels in the correct location on the diagram. (One item will not be labeled) Ribosome…

A: The process of making protein molecules is called protein synthesis. It includes amino acid…

Q: Compare and contrast the structure and function of the following among bacteria and eukaryotes: a.…

A: In bacteria, ribosomes are cellular structures responsible for protein synthesis. They are composed…

Q: ADPH is an important coenzyme. Which of the following occurs during the Calvin cycle in plants? A.…

A: Photosynthesis is a process by which green plants prepare their own food with the help of sunlight,…

Q: Ester Lederberg's discovery of the lambda phage and F-plasmid were significant because: (select all…

A: The lambda phage is a bacteriophage that infects bacteria, specifically Escherichia coli (E. coli)…

Q: The images represent a maternal sample, the placenta, and the cord blood. The letters ON the cells…

A: Given information Antibodies in the plasma Mother Cord blood Anti-A, Anti-B, Anti-Fya, Anti-A,…

Q: what are the qualities of the third phosphate bond in ATP? there may be more than one.  - stable -…

A: Metabolism can be defined as the collection of all the chemical reactions involved in maintaining…

Q: What is water saturated phenol and what is its function in RNA extraction?

A: Water-saturated phenol, commonly known as phenol:chloroform:isoamyl alcohol (25:24:1), is a vital…

Q: In each of the following pedigrees (C, D) by inspection, determine the mode of inheritance involved.…

A: A pedigree is a graph that shows a family's genetic history over numerous generations. Women are…

Q: Dichotomous key construction. Create a dichotomous key using the genera/species and characteristics…

A: Dichotomous KeysA dichotomous key is a tool that allows the user to determine the identity of items…

Q: What are the ethical implications of genetic engineering and cloning?

A: In the process of genetic engineering we add, remove or modify genes ( DNA) to change the…

Q: In your own words explain the term “phagocytosis” and discuss the three (3) stages that are…

A: The immune response is a complex physiological process in which the body defends itself against…

Q: What is a loading buffer and how does it function? What does 10x loading buffer mean?

A: Gel electrophoresis is a technique extensively used in molecular biology research to separate and…

Q: Embryo is a solid ball of cells 2.(a) Describe the difference between pluripotent and multipotent…

A: Human stem cells are unique cells with the capacity to develop into multiple cell types. They can be…

Q: What is lignin and its role in plants? Why can reducing the amount of lignin in trees enhance the…

A: Note:- Sticking to our guidelines I have answered only ist three questions. Please ask rest of the…

Q: Wolves Elk Willow Trend in population size or amount of growth Explanation for this trend

A: A trophic cascade is an ecological phenomenon in which a population in the food chain reduces…

Q: 5.1 emphasized the term 'not-yet-culturables over 'unculturables' for those microbes difficult to…

A: Bacteria may occur in a symbiotic or in a parasitic relationship with their host. Sometimes they may…

Q: For questions 1-3; indicate whether the sentence or statement is true or false. If false, rewrite…

A: Living organisms need energy for doing cellular activities and this energy is produced by the…

Q: Name a technique you would use to assess whether the gene Np1 is required for pain sensation? (Check…

A: To assess whether the gene Np1 is required for pain sensation, the following techniques can be used:

Q: Explain (using the correct terminology and drawing an image) what happens to the cells in the…

A: The theory of osmosis is a fundamental concept in biology and physical chemistry that explains the…

Q: Refer to the experimental approach (i.e., very briefly describe) and give the results AND…

A: A short RNA molecule called a microRNA, or miR-145 is involved in the post-transcriptional…

Q: Ferns are a type of terrestrial plant that does not produce seeds, unlike gymnosperms and flowering…

A: The ability to produce seeds has provided significant advantages to gymnosperms and flowering plants…

Q: 1.In a cell culture you are tracking cell division and DNA replication. You start with 100 cells,…

A: The DNA replication occur in semiconservative manner in which daughter DNA contain one old strand…

Q: How do the researchers propose to use cancer sniffing worms in real life

A: Any of the several illnesses characterised by the well define specific term that is the growth of…

Q: After establishing the importance of cGMP in the signaling pathway of the photoreceptor cells, the…

A: In order to comprehend cGMP's function in the signaling cascade of photoreceptor cells, researchers…

Q: Classify each situation as density-dependent or density-independent AND explain your reasoning.  a.…

A: The group of organisms of same species that are present in a particular area at a particular time is…

Q: Consider this claim: Changes in environmental conditions always result in new ecosystems and loss of…

A: The relationship between environmental conditions and ecosystems, as well as their impact on…

Q: Swim bladders in fish and lungs in terrestrial animals have a common evolutionary origin, but have…

A: Swim bladders in fish and lungs in terrestrial animals have a common evolutionary origin,…

Q: You are interested in examining the internal structures of a living cell, what type of microscopy…

A: One type of instrument by which we can see small object even the internal structure of any cell is…

Q: A. What is the name of the specific sequence the scientists are measuring in the experiment shown…

A: DNA, or Deoxyribonucleic acid, is the genetic and hereditary material of all cells that contains…

Q: Explain how muscle velocity changes with varying muscle force (tension) during the different types…

A: The process in which the fascicles i.e. the muscle fibers become short and enlarges to produce…

Q: Which of the following terms is NOT used to describe microbes thrive in different temperature…

A: Microbes are extraordinarily adaptable and varied creatures that can live and flourish in a variety…

Q: i. Explain the behaviour of the amino acids (Alanine, Lysine, aspartic acid) during the ion exchange…

A: In column chromatography the elution process involves passing a sample through a column packed with…

Q: Retinal is therefore a key player that triggers a series of activation in phototransduction (see…

A: Several chemical mechanisms are involved in the phototransduction process in photoreceptor cells,…

Q: Question 1 Interpret why halophilic lactic acid bacteria (HLAB) isolated from environmental samples…

A: Humans have incorporated fermented foods into their diets because of their multiple health…

Q: 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. Match the following organelles with the…

A: Cell is defined as the basic structural and fundamental unit of life. The study of the structure of…

Q: 5. Consider mitotic division. In which phase do kinetochore-microtubules depolymerize? A. Metaphase…

A: Mitosis is the division of one parent cell into two identical daughter cells with a complete set of…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.