Question
This organelle stores the DNA
O ribosome
O nucleus
O mitohandria
Expand
Transcribed Image Text

This organelle stores the DNA O ribosome O nucleus O mitohandria

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Cell Biology

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Why are oxygen molecules important in oxidative phosphorylation? What are the consequences if they a...

A: The presence of oxygen is important in order to receive electrons from the protein complexes. This s...

Q: Pickles are made by immersing cucumbers in a concentrated saltwater solution. The pickling process i...

A: Ans. When making pickles from fresh cucumbers, saltwater soaking, or brining, is widely used to extr...

Q: Name three factors that can influence the mutation rates of human genes.

A: Mutation :  It is defined as a change in a DNA ( Deoxyribonucleic acid) sequence because of the mist...

Q: What are the conclusion(s) of the Hershey and Chase experiment?

A: Hershey and Chase Experiment - Hershey and Chase Experiment is also called as Blenders Experiment Th...

Q: How does the poisoncyanide act upon the aerobicrespiration?

A: Cellular respiration is a set of metabolic reactions and processes that take place in the cells of o...

Q: 8. Using the partial structure shown below, write the structure of ATP, ADP, and AMP: -P-O-adenosine...

A: ADENOSINE  The molecule consists of an adenine attached to a ribose via a β-N9-glycosidic bond.  It ...

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name o...

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one...

Q: Would the function of KRAS gene be lost or gained in MDA-MB-231 breast cancer derived cells? Please ...

A: KRAS gene is a gene present on the short arm of chromosome 12 that is responsible for the formation ...

Q: Which of the following is not one of the tenets of the chromosome theory of inheritance?a. Chromosom...

A: Genotype is the genetic makeup of an organism. Chromosomes are the large molecules of genes or DNA. ...

Q: In the mitosis experiment, in what stage were most of the onion root tip cells in? Based on what you...

A: Introduction  Cytology refers to the study of cell such as cell morphology, physiology etc. As we kn...

Q: Which of the following is the function of transfer RNA? a.Makes up the structure of ribosomes ...

A: The central dogma states that the DNA is transcripted into RNA which is translated into proteins. Th...

Q: 2. What shapes result from secondary structure: a) β- helix & α-sheets b) α-helix and β-sheets...

A: Proteins are composed of amino acids that are joined together to form large polypeptide chains. The ...

Q: What is the principle component of dietary fiber?

A: Dietary fibres are the edible parts of a plant or they are analogous carbohydrates that are resistan...

Q: Which of the following amino acids is carried by the tRNA that initiates translation in eukaryotes? ...

A: If tRNA carries Methionine Amino acid, it initiates translation in Eukaryotes.

Q: 23. Which is not a function of proteins: a) catalyzing reactions b) structural properties such...

A: Option (c) is the answer, as it is not a function of protein. 

Q: The following diagram represents one of the Christmas-tree-like structures shown in Figure  On the d...

A: DNA molecule is composed of two polynucleotide chains and coil in a double helix. The molecule consi...

Q: Biology Question

A: The esophagus transports food from the oral cavity to the stomach. It is lined by a stratified squam...

Q: Protecting biodiversity 1. What characteristics make a species MORE susceptible to extinction/endang...

A: As per our honor code, we are allowed to answer one question at a time. You have posted multiple que...

Q: 25. All of the chemical reactions conducted by a specific organism: a) anabolism b) catabolism...

A: Biomolecules such as carbohydrates, lipids, proteins, vitamins, and minerals are essential to all li...

Q: a. Why does syphilis have such profound effects on the human body?b. Why is long-term immunity to sy...

A: Syphilis is a highly contagious disease that is mostly spread by sexual activity. Syphilis is caused...

Q: Which economically important product is obtained from Cycas circinalis?

A: Cycas circinalis is also referred to as the "queen sago". It belongs to cycad species, mainly known ...

Q: 10. Replication is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide ...

A: CENTRAL DOGMA- It is the process when DNA replicates itself means it will make copies of itself with...

Q: mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’  -Draw a box around the sequence where protein synthesis wil...

A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) When DNA changes into...