Question
Asked Feb 29, 2020
1 views

Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base:

5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’

check_circle

Expert Answer

Step 1

The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information from one generation to the next generation. It consists of two strands of polynucleotide chains that are wind around each other to for...

Want to see the full answer?

See Solution

Check out a sample Q&A here.

Want to see this answer and more?

Solutions are written by subject experts who are available 24/7. Questions are typically answered within 1 hour.*

See Solution
*Response times may vary by subject and question.

Related Biology Q&A

Find answers to questions asked by student like you
Show more Q&A
add
question_answer

Q: Compare and contrast positive pressure breathing and negative pressure breathing. Please give an exa...

A: Hi! Thanks for your question. But as you have posted multiple questions, I am answering only the fir...

question_answer

Q: Hi, there! Just subscribed to Bartleby! So excited to be here, and thanks for your help! Can you ass...

A: An instrument that is used to see extremely small objects that cannot be seen by naked eyes is terme...

question_answer

Q: If the potato is allowed to dehydrate by sitting in open air, would the potato cells be more likely ...

A: Potatoes are the tubers that grow on the plant Solanum tuberosum. It is typically composed of 2% pro...

question_answer

Q: 15) The discontinuous aspect of replication of DNA in vivo is caused by ________. A) topoisomerases ...

A: The biological process by which two identical copies of DNA are formed from the given DNA strands. D...

question_answer

Q: what are kidney stones? causes, symptoms and treatmetns..

A: Kidney stones are the hard deposits substances made of minerals and salts inside the kidney. When th...

question_answer

Q: how many bones in human body?

A: Bone is one of the most important connective tissue of the body. Bones are the rigid organ made of t...

question_answer

Q: please help me

A: The Cambrian Period marks a significant point in the history of life on Earth. During this time, mos...

question_answer

Q: Why did you perform the catalase test on colonies growing on nutrient agar plates but not on the blo...

A: Catalase test is used to identify the presence of catalase enzyme in the bacteria. Catalase is an en...

question_answer

Q: 2. You use tubes to test aerotolerance of bacteria. From your samples you have 3 results: A. Bacteri...

A: Hello, thank you for your question. As per our policy, I am going to answer only the first question....