Use the following information to answer the next four questions. Nucleic Acid 3'TAGATTCCGATCGAAGGTTCCTAGCATGAACGATCAATTCCGG" 1. Identify the type of nucleic acid found above. 2. Write the complementary strand for it. 3. If the replication fork occurs on either end of this strand open up the strand and place RNA primers in the appropriate places (one for the leading strand and two for the lagging strand). Using arrows show the direction of strand synthesis for each template strand and label each as leading for lagging strands. 4. If the RNA primer is four bases long identify the bases in the primer for each leading strand. The bases in bold indicate the location where the RNA primers would bind.

Q: 5'- -3'

A: The mechanism by which a double-stranded DNA molecule is replicated to create two equivalent DNA…

Q: Answer the following:  DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' 1. is % of guanine…

A: The central dogma of life is that DNA self replicates to form its own copies. The copied DNA is…

Q: “DNA polymerase plays a dual function during DNA replication” comment onstatement?

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: Answer the following questions. A) Write the protein that catalyzes the formation of phosphodiester…

A: Thousands of different enzymes catalyze metabolic processes in cells. Enzymes are proteins that…

Q: Match the following descriptions with the enzymes involved in DNA replication. 1. Adds an RNA primer…

A: Replication is the synthesis of new DNA molecules from the parental DNA.

Q: As you watch the video, answer the questions. The questions are in sequential order. 1) True or…

A: We are not supposed to use external links so answer are based in general point of view. Also in case…

Q: explain why you chose that answer. Your explanation should discuss the replication of DNA in…

A: DNA replication is the process by which a double-stranded DNA particle is duplicated to deliver two…

Q: The following is the sequence on one of a DNA molecule A A T G C C A G T G G T 1. If this strand is…

A: “Since you have posted a question with multiple sub-parts, we will solve first three sub parts for…

Q: Letter 'd' corresponds to 5' 5' 3' origin of replication. primer. O replication fork. O Okazaki…

A: The Central Dogma theory states that DNA makes RNA and RNA makes proteins. DNA replication is the…

Q: Refer to the image and answer the questions. 1. Which among the two strands will have a continuous…

A: A replication fork is formed when double-stranded DNA molecules are separated into single strands…

Q: The illumina method of sequencing uses a unique type of nucleotide building block. What is the…

A: The illumina sequencing is a DNA sequencing method used to determine single nucleotide bases of a…

Q: The following diagram uses colors to illustrate the replication of a chromosome. Use your knowledge…

A: DNA is the genetic material which stores all the genomic information needed for survival of any…

Q: True or False: Polymerases open the DNA and create the replication bubble while helicases run…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around one…

Q: Determine the complementary strand of DNA that forms on this template DNA fragment during…

A: The complementary strand of the DNA fragment during the replication : 3' CCAAAGAAGTTCTCT 5'

Q: Compare to the original double helix, evaluate the copies made during three attempts of DNA…

A: DNA has a double stranded structure. During DNA replication, the DNA double helix unwinds & each…

Q: During DNA replication, one of the new strands of DNA is synthesized continuously, while the other…

A: DNA is a molecule that has a repeating chain of identical five-carbon sugars (polymers) linked…

Q: What is the name of the process of rehybridization of melted DNA? replication denaturation annealing…

A: DNA hybridization is the process, in which two strands of the complementary DNA are joined to form…

Q: Describe the synthesis of the leading strand during DNA replication. Assume the replication bubble…

A:

Q: 1. Explain how the synthesis of a DNA daughter strand growing toward a replication fork differs from…

A: DNA is deoxy ribonucleic acid that is present as a genetic material is living organism along with…

Q: i) Assume that the following polynucleotide is part of a longer DNA molecule. Write out the product…

A: DNA  It is defined as a genetic material which has all the stored genetic information of an…

Q: Given a part of DNA undergoing replication. Copy and write the . CTGATTCCGAA TG5 corresponding bases…

A: By DNA replication process, cell duplicates its DNA copy and is essential for transfer of equal…

Q: Select the CORRECT statement. Guanine always pairs with cytosine in DNA. DNA is twisted into a…

A: Introduction  DNA is the basic genetic material found in most of the species. DNA stands for…

Q: Referring to the figure, what bases will be added as DNA replication proceeds on the bottom strand?…

A: Answer: REPLICATION: It is the step in the central dogma in which synthesis of DNA occured to form…

Q: When comparing the three key models of DNA replication, the model that included the separation of…

A: DNA replication (also called DNA synthesis) is essentially a process of making new DNA from the…

Q: DNA Fragments: CGATCT TCACGA AGCTGC GGCTAA ATGCTG GTACCA Select the correct fragments from the…

A: DNA is a nucleic acid that is present in the nucleus of eukaryotic cells and the nucleoid region of…

Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

A: Plasmids are circular double-stranded DNA elements. These are found in prokaryotes. The plasmids…

Q: Answer the following 2 questions based on the given sequence of DNA. The top strand is the template…

A: The central dogma of DNA consists of transcription and translation. In transcription, the DNA makes…

Q: The following diagram represents the template strands of a replication bubble in a DNA molecule.…

A: DNA replication is a process in which two DNA molecules are synthesized from a single DNA molecule.…

Q: The Escherichia coli chromosome is a circular DNA molecule and contains a single origin of…

A: Introduction :  DNA replication  in E.coli is a process through which daughter DNA synthesized from…

Q: Assume that you are a RNA polymerase. Which strand is the template strand?…

A: Second one is the template strand for RNA polymerase.

Q: Draw the following segment of DNA molecule. Show the important covalent and non-covalent…

A: Covalent bond is formed by sharing of electrons between adjacent atoms. For example, bond formed…

Q: Single-stranded regions of DNA are attacked by nucleasesin the cell, yet portions of DNA are in a…

A: DNA replication is the process of synthesizing new strands of DNA from the original double-helical…

Q: Match Column A with Column B. unwinds the two DNA strands at the replication A. DNA Gyrase fork B.…

A: DNA is the genetic material. In replication two copies of DNA are made.

Q: tabulate 2 differences between DNA replication, the process of trancsription and translation…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Sort the phrases into the appropriate bins depending on which protein they describe. 1) Binds at the…

A: Deoxyribonucleic acid (DNA) replication process involves copying DNA from the existing DNA. In DNA…

Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two…

A: During DNA replication, the double stranded DNA molecules are separated into single strands and…

Q: For the following DNA sequence along a chromosome answer the following questions:     The enzymes…

A: The first is referred to as the leading thread. This is the parent strand of DNA, which travels in…

Q: (c) Discuss the process of replication of DNA. (d) Derive Michaelis-Menten equation of enzymatic…

A: DNA is present in the nucleus of the cell and it is the genetic information that defines every…

Q: Use the following information to answer the next question. A small segment of DNA has the following…

A: DNA is the genetic material of almost all organisms. They contain genes and inherit those to the…

Q: Place the following steps of DNA replication in order (from left to right) from the beginning to the…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Why does DNA have a leading strand and a lagging strand during replication? Select the correct row…

A: Replication is the process of copying the DNA strands. It occurs through a series of events with…

Q: Read the passage below and indicate what it means when DNA replication is described as a…

A: DNA replication is the process by which a double-stranded DNA molecule is copied to produce two…

Q: What enzymes are required for the initiation of replication in eukaryotes? Are these complexes the…

A: DNA replication in eukaryotes takes place in three stages: initiation, elongation, and termination,…

Q: Label the following diagram using the words from the word box below. You can write your answers in…

A: As per our company guideline we are supposed to answer only first question or first 3 subparts of…

Q: Identify if the statement is correct or incorrect, "DNA synthesis begins at specific nucleotide…

A: DNA replication is the process by which DNA generates a copy of itself during cell division using a…

Q: Each of the following terms refers to the replication of chromosomes. Describe the role…

A: Replication is a process by which DNA forms its copies using previously present DNA as template. It…

Q: Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to…

A: The messenger RNA (mRNA) sequence is given, and we are asked to determine the complementary…

Q: Regular DNA replication Question 3 options: Occurs through the addition of nucleotides to the end of…

A: dna replication is the process by which new dna molecules are produced from parent dna molecule .

Q: atch the diagram with the correct term listed below.   Structures Letter Okazaki fragments Answer…

A: DNA replication is a semi conservative process. By this process an organism makes a copy of itself…

Q: 384 Answer all the questions below please! Required: At least 3-4 sentences for each answer Write…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.