Using the information provided below, which of the individuals A and B have: i) Genotypic change i) Phenotypic change iii) Genotypic and phenotypic change X is the partial CDNA sequence of the normal CFTR gene. Use this to determine which DNA sequence (A &B) is the DNA extracted from a patient with and without disease. X) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACA Met. A V IR Q FP W A V Q T WY D SL GA I N.. A) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACAGGTATGACTCTCTTGGAGCAATAAACAA Met. B) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACTTGGTATGACTCTCTTGGAGCAATAAACA Met. Since this is a complementary DNA (CDNA) The nucleotide "T" can be directly replaced with U to get the MRNA strand. Example: ATG is AUG, TCA is UCA etc Second letter A G UAUTv UGulcvs UACS UAA Stop UGA Stop A UAG Stop UGG Trp G UUU Phe UCU UCU UUC J UGCCYS UCC Ser UUA) UUG Leu UCG UCA CUU CUC CỦA CUG CAUTHIS CACS CAAGIN CGU CCU CCC CCA CCG CGC Leu Pro Arg CGA CAGJ Gin CG AAUAS AGUser AUU AUC le A AUA ACU ACC ACA AAC Asn AAA AGC Thr AUG Met ACG AAGLYS AGG JArg G. GUU GUC GUA GUG GCU GCC GEA Ala GGU GGC GAUT GACASP GGA Gly GAA GAG Glu GGG GCG G. First letter Third letter

Using the information provided below, which of the individuals A and B have: i) Genotypic change i) Phenotypic change iii) Genotypic and phenotypic change X is the partial CDNA sequence of the normal CFTR gene. Use this to determine which DNA sequence (A &B) is the DNA extracted from a patient with and without disease. X) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACA Met. A V IR Q FP W A V Q T WY D SL GA I N.. A) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACAGGTATGACTCTCTTGGAGCAATAAACAA Met. B) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACTTGGTATGACTCTCTTGGAGCAATAAACA Met. Since this is a complementary DNA (CDNA) The nucleotide "T" can be directly replaced with U to get the MRNA strand. Example: ATG is AUG, TCA is UCA etc Second letter A G UAUTv UGulcvs UACS UAA Stop UGA Stop A UAG Stop UGG Trp G UUU Phe UCU UCU UUC J UGCCYS UCC Ser UUA) UUG Leu UCG UCA CUU CUC CỦA CUG CAUTHIS CACS CAAGIN CGU CCU CCC CCA CCG CGC Leu Pro Arg CGA CAGJ Gin CG AAUAS AGUser AUU AUC le A AUA ACU ACC ACA AAC Asn AAA AGC Thr AUG Met ACG AAGLYS AGG JArg G. GUU GUC GUA GUG GCU GCC GEA Ala GGU GGC GAUT GACASP GGA Gly GAA GAG Glu GGG GCG G. First letter Third letter

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

What are the possible genotypes of the PTC locus?
What is a STEMI? What is the underlying mechanism of this?
What is an ORF and how is it determined?
If a vector containing the desired gene X is inserted into a microorganism, for instance, A.carbornarious, and the protoplast transformation resulted in 9 gene X transformants, how to determine which transformant has the highest titer of gene X?
In the plaque assay, what is the precise origin of a single plaque?
Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion protein: ATATGCATCACCATCACCATCACATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATTAA
Using the “target DNA” sequence provided in the attached image, what sizes of inserts can be prepared using HindIII digestion? Which one contains the coding sequence?
How long is the COI gene?
During the first successful gene therapy trial in which Ashanti DeSilva was treated for SCID, did the therapeutic gene delivered to Ashanti replace the defective copy of the ADA gene? Why were white blood cells chosen as the targets for the therapeutic gene?
What is 15q?
How long is the CFTR gene and what are the first 20 nucleotides of this gene?
"Genome-Wide Association Studies Identify Genome Variations That Contribute to Disease" Explain this ?