We are given a random DNA sequence (each of the 4 bases has equal probability of occurring at each position in the sequence). A. What is the probability that three adjacent bases (a triplet) encode a stop codon? B. What is the probability that a given triplet is not a stop codon? C. What is the probability that neither of two adjacent triplets is a stop codon?
Q: It is conceivable for codons encoding a single amino acid to share the first two bases while…
A: Protein synthesis occurs in all organisms in two main steps: transcription and translation. DNA…
Q: if there are multiple start condo, how can you identify the real start codon? a) By observing…
A: The DNA or RNA sequence consists of three nucleotides and determines the particular amino acid that…
Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10° D. In your answers,…
A: The molecular mass of Escherichia coli DNA genome is 3.1 × 109 Daltons. The average molecular weight…
Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10 9 D. In your…
A: Hi! As you have posted multiple questions, I will be answering the first and third question for you.…
Q: a) In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of the three possible)…
A: Since you have asked multiple questions with multiple parts, we will answer only the first three…
Q: If you know the sequence of amino acids in a protein, what does the genetic code table allow you to…
A: Amino acids are the building blocks of proteins. Proteins serve as structural support inside the…
Q: The base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T,…
A: Most organisms contain DNA or deoxyribonucleic acid as their genetic material. It is a type of…
Q: Consider the following 2 codons sequences. Codon sequence 1: ACU AGA GAU GUC UGC Codon sequence…
A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…
Q: What is Simple sequence repeat?
A: The genome of every individual contains millions of genetic variation or variants which make each…
Q: Below is a sequence of DNA.…
A: The process of identifying the coding region and the position of a gene in a genome is known as gene…
Q: For a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the…
A: The complexity of an organism is based on the functioning of its genome. Deoxyribonucleic acid (DNA)…
Q: You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To…
A: In PCR, forward and reverse primers are to be added. PCR involves denaturation, annealing and…
Q: A scientist wants to use a technique that allows to shuffle protein domains. Protein A and Protein B…
A: Ans: Protein domain: The protein carries separate region in the polypeptide protein which shows…
Q: Why do you expect to encounter a stop codon about every 20 codons or so in a random sequence of DNA?
A: During the translation process, the termination step occurs when the Stop codon in mRNA comes and…
Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10° D. In your answers,…
A: Given data: The molecular mass of the genome of Escherichia coli = 3.1 x 109 Da. The average…
Q: The DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17…
A: The bacteriophage is those viruses that have the capability to infect bacteria and reproduce inside…
Q: What type of mutation (missense, silent, and non-sense) was introduced in your sequence when G was…
A:
Q: Please by using the first base of each as the first triplet in a condo, how do I translate two…
A: Translation Translation is the process in which the mRNA or messenger RNA is get translated. mRNA of…
Q: The E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how…
A: Recombination is the process of genetic reshuffling where the genetic material is shared within or…
Q: . In analyzing the number of different bases in a DNAsample, which result would be consistent with…
A: The DNA (Deoxyribonucleic acid) comprises two types of nitrogenous bases including the purines and…
Q: Suppose that a nearly perfect 20-base-pair inverted repeat is observed in a DNA sequence. Provide…
A: The copies of the DNA sequences that are organized in opposing orientation are called “inverted…
Q: What is the length in basepairs of these sequences? How many base substitutions are there between…
A: The multiple sequence alignment (MSA) involves the alignment of three or greater than three…
Q: If A represents 40% of the nucleotides in a particular piece of double stranded DNA, how often will…
A: As per Chargaff's rule, Amount of adenine = amount of thymine Amount of guanine = amount of cytosine
Q: Which of the following features is associated with the Watson and Crick model of the DNA? A a purine…
A: DNA stands for deoxyribonucleic acid and it has a double-helical structure. The backbone of the DNA…
Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…
A: The bacterium Escherichia coli, commonly known as E. coli belongs to the family of gram negative…
Q: A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is…
A: DNA is the genetic material of the cell which gets transcribed into mRNA with the help of RNA…
Q: Consider the following sequence of DNA: 3'-TTA CGG-5' What dipeptide is formed from this DNA after…
A: The genetic information is present in the sequences of the DNA. The sequence of DNA that runs in the…
Q: Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA?
A: Introduction : Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are probably the most…
Q: (a) What will be the problem during DNA replication if the enzyme primase becomes non-functional?…
A: DNA replication a process by which DNA makes copies of itself and this process requires lots of…
Q: Suppose that codons consisted of 4 nucleotides instead of 3 and that there were only 2 different…
A:
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: DNA is first transcribed into messenger RNA and then mRNA is translated into protein sequence.
Q: (a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many…
A: The process of translation or protein synthesis occurs in the cytoplasm of a cell in both…
Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…
A: Hemoglobin present in red blood cells helps in the transport of oxygen molecule to and from various…
Q: Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code…
A: Note - We answer one question at a time. The set of rules through which information in the DNA or…
Q: You are characterizing a DNA-binding protein, and have used genetic experiments to identify a domain…
A: Proteins have a secondary structure which is 3D one and the two most common of these are the alpha…
Q: A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon…
A: DNA is the carrier of genetic information in almost all organisms except certain RNA viruses such as…
Q: The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in…
A: In the mammalian genome, DNA methylation is an epigenetic mechanism involving the transfer of a…
Q: A standard codon table such as the one that we looked at in class gives the following information:
A: Three types of RNA interact to synthesize proteins. They are mRNA, tRNA, and rRNA.mRNA is the…
Q: In Watson and Crick's model of DNA structure, the two strands of the DNA double helix are joined…
A: The Watson Crick model of DNA 1953 is a double stranded, helical molecules.
Q: You sequence a new tRNA and discover that the anticodon sequence is 5'-IGC-3. What amino acid does…
A: I corresponds to an unusual bas hypoxanthine, which is found in tRNA
Q: Using the figure below identify: What is a function of introns and exons? What is a role of mobile…
A: DNA is packed up compactly in the nucleus of a cell in close association with histone proteins…
Q: Consider a three-base sequence in the template of DNA: 5' . . . 123 . . .3', in which 1, 2, and 3…
A: Here the 1,2 and 3 stand for the relative position of nucleotides . The mRNA sequence would be…
Q: a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four…
A: The genetic code is a system of principles that live cells employ to convert data contained in…
Q: Consider the following sequence of DNA: 3'-AGA CCC-5'. a. What dipeptide is formed from this DNA…
A: Mutations can be the change in the sequence of DNA and RNA, and mutations can be caused by a…
Q: AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What…
A: Short Tandem Repeats(STR) or microsatellites or simple sequence repeats(SSR) are short sequences of…
Q: Do you think it is possible that interchain disulfide bonds is present in the protein? Explain. b.…
A: Disulfide bond is the post-translational modification occurs in Endoplasmic reticulum. Disulfide…
Q: If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it…
A: An anticodon is a trinucleotide sequence that is complementary to that of a corresponding codon in…
Q: (a) Is it biologically advantageous that DNAis stable? Why or why not? (b) Is it biologically…
A: The two major types of nucleic acids are DNA and RNA. They are made from nucleotides, containing a…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- a. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four different bases. How many possible unique codons are there?b. If DNA had only two types of bases instead offour, how long would codons need to be to specify all20 amino acids?The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following questions: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain your answer. b) Would methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove?
- The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers, show how you came up to each result? (a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in mm?If you know the sequence of amino acids in a protein, what does the genetic code table allow you to infer about the sequence of base pairs in the gene that specifies that protein?The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following question: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain b) Could methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove? Explain your answer.
- Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixIf the genetic code used 4 bases at a time, how many amino acids could be encoded?
- Which of the following (A through E ) would you expect to find in a nucleotide chain constructed for Sanger sequencing?Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?Let’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?