We use a NanoDrop spectrophotometer to analyze plasmid DNA obtained from miniprep. What information about the plasmid does the 260nm reading alone provide and why? Include in your answer the specific information known about DNA absorption of UV light that allows for calculation of this information from the 260nm reading. (3pt)

We use a NanoDrop spectrophotometer to analyze plasmid DNA obtained from miniprep. What information about the plasmid does the 260nm reading alone provide and why? Include in your answer the specific information known about DNA absorption of UV light that allows for calculation of this information from the 260nm reading. (3pt)

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 3TYK: Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning...

See similar textbooks

Similar questions

What information and materials are needed to amplify region of DNA using PCR?
After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify the DNA. b. convert cDNA into genomic DNA. c. convert cDNA into messenger RNA. d. verify that the desired DNA sequence has been amplified. e. synthesize primer DNA molecules.
1 (a) What do ApR, TcR, and ori on the pBR322 map represent and discuss there individual functions? (b)Does the undigested plasmid show more than a single band when electrophoresed? Why? (c)What other kinds of molecules, in addition to plasmid DNA would you expect to find in a sample of plasmid DNA extraction? (This is not a graded assignment)
2. You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on ampicillin plates con-taining X-gal and pick one blue colony and one white colony. When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
2. A plasmid was digested with the enzyme EcoRI. On agarose gel electrophoresis, you observe four bands, 200, 550, 1200, and 4600 bp. a. How many EcoRI sites are present in this plasmid? b. What are the distances between each site? c. What is the size of the plasmid?
1. If you do an absorbance reading after plasmid purification and get a A260/A280 of less than 1.8, how could you further purify the sample to get rid of the protein contamination? Is it always necessary to have completely pure DNA? What are some cases where it would or would not be?
1. Below is an illustration of two plasmids: the incomplete pKAN-R which contains the gene of interest (rfp), and the good plasmid vector pARA which contains the ampR gene for ampicillin resistance, the araC activator gene and the ori region. Based on this, how are you going assemble to create the desired recombinant plasmid containing all the necessary components? (Keywords: Identify correct restriction enzymes to use to create specific sticky end sequences that will only assemble with the final vector in one orientation)
1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
1. Briefly explain why the total size of the pMBBS plasmid in the Restriction Enzymes practical is 3000bp (base pairs) 2. Briefly explain why the cut sites on the pMBBS plasmid in each Restriction Enzymes (EcoRI, BamHI, and XhoI) just 1 each 3. Briefly explain what led to the 5 fragments formed which linked to the 500bp, 1000bp, 1500bp, 2000bp, 2500bp sizes
4. What is the name of the process by which bacteria pick up a different organism’s geneticmaterial?5. Genetically, how does the original bacterial DNA (plasmid) differ from the final bacterial DNAmolecule? (Do not say, “It is longer.”)6. Tetracycline is an antibiotic that is prescribed to kill bacterial infections. The transformedbacterial cell that you created has the tetracycline resistant gene in it. If this cell is placed on agrowth medium with tetracycline, will the bacteria grow or die? Explain.
1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions.a. PscI & GsuIb. ScaI, PdmI & BsaXI c.ScaI, SspI & EheI