What are some other prezygotic reproductive barriers besides a mating dance?

Q: Consider the reaction: Ketoglomerate + NAD --> ketocitrate + NADH   In the reaction to the left,…

A: Cellular respiration is a phenomenon in which glucose is used up and energy is liberated. It…

Q: properties of the Ach nicotinic receptors, EXCEPT are hexameric macromolecules when open allow the…

A: The "brain" is organized into two types of tissue: grey matter, which is composed of mixed neuronal…

Q: The mouth is part of our digestive system. It would make sense then, that we would have more of the…

A: Cells are dynamic in the sense that they employ energy to accomplish a range of cell tasks such as…

Q: 1.  In 3 sheets of bond paper, draw the mitosis, meiosis 1 and meiosis 2.  2.  Fold each sheet into…

A: A cell divides into two genetically identical daughter cells during the process of mitosis. Meiosis…

Q: Which of the following processes and or mechanisms of evolution violate the assumptions of…

A: The Hardy-Weinberg principle states that a population’s allele and genotype frequencies will remain…

Q: 6. When comparing genes that are conserved between species, the exons are more likely to be related…

A: Exons are nucleic acid coding sequences that are found in mRNA. Introns are non-coding sequences…

Q: You find that in a population of a butterfly species that that the frequency of allele 1 at the…

A: Hardy-Weinberg Equilibrium the formula is --- p² + 2pq+ q²= 1  p² = dominant homozygous frequency q²…

Q: a. A triploid cell in females

A: Tiploid cell in females :  Triploid is a rare chromosomal abnormality. Triploid is the presence of…

Q: 12. Vitamin C: coenzyme form, functional groups, mechanism of action, biological role, sources,…

A: Vitamins are organic compounds that are required for various biological functions such as growth,…

Q: Concept Map: Complete the attached Systematics Concept Map. Type your answer on each level in the…

A: Phylogeny is an applicable biological procedure for determining what genus a species belongs to…

Q: Introduction: The introduction explains the purpose and objectives of the experiment. A good way to…

A: The collection of methods in biology known as "experimental biology" focus on using experiments to…

Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…

A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…

Q: Which of the following statements about convergent evolution is true? (a) It demonstrates how…

A: Evolution means an organism is keep evolving or bettering itself during the course of time. The gene…

Q: 2. What link of a contour of biological regulation provides possibility of regulation "on a…

A: Introduction The contour of biological regulation:- It is a way for information processing &…

Q: If two different organisms are closely related evolutionarily, then they will (a) be similar in…

A: Any accumulated or cumulative change in an organism's or population's features over a long period of…

Q: The endplate potential decreases with distance because

A: The end plate potential is a potential that propagates to the neighbouring patch of muscle fibre…

Q: a. A triploid cell in females b. tetrasomic cell in males c. tetraploid cell in females

A: The ploidy of a cell refers to the number of sets of homologous chromosomes present in the cell.…

Q: The girl is focusing a slide and she is turning the coarse adjustment knob up toward the slide.  A.…

A: An optical microscope has the following parts:- A stage for placing the slide A set of objective…

Q: orange [yr] snap dragon is of a cross between a yellow [yy] snap dragon and a red[rr] snap dragon…

A: When neither trait is truly dominant over the other, incomplete dominance results. This implies that…

Q: Cat DNA is much more similar to dog DNA than to tortoise DNA. Why? (a) Cats and dogs are both…

A: All living things have the same genetic material (DNA), comparable genetic codes, and the same…

Q: If you are trying to set up a PCR with a total volume of 40uL and you have access to a stock…

A: Inroduction DNA replication occurs in our body. But PCR or polymerase chain reaction  is a…

Q: Arrange and match in chronological order the pathway of water in syconoid sponges: Dermal ostium…

A: Sponges  Sponges belong to the kingdom porifera also knows as pore bearing animals.

Q: Write the class that exhibits the followin characteristics: Presence of velum in medusae Hydrozoa…

A: Velum is a membrane or membranous structure that covering another structure.planula is free-swimming…

Q: How does tris act as a buffer? What about its composition allows it to act like a buffer?

A: Protein electrophoresis and western blotting both require tris buffers. Tris is used as a buffer in…

Q: Time (hours) # of cells 1 2 64 0 ½ 4 6 10 19 32 110 10,000 30,000 80,000 170,000 106 Notes Egg is…

A: Introduction :  The cell cycle (also known as cell division) is an organised series of cellular…

Q: Which of the following is true of mitchondria and plastid evolution in Eukaryotes Plastids evolved…

A: Mitochondria A organelle of eukaryotic cell that performs the function of respiration.

Q: Question 9 of 14 Which of the following acts as a signal for the dendritic cell to begin…

A: Cross-presentation is the process by which specific MHC class I-expressing professional…

Q: In the schematic diagram of a eukaryotic cell below, which processes (I-V) listed below take place…

A: The process of copying DNA to RNA is known as transcription, and the process of using RNA to make…

Q: One of your classmates performed a gram stain on Pseudomonas aeruginosa and found variable gram…

A: The "cell wall of Gram-positive" bacteria is mostly composed of peptidoglycan layers that form a…

Q: What happens if plasma membrane fails to maintain optimal fluidity?

A: Introduction : All cells have a cell membrane, also known as a plasma membrane, which separates the…

Q: Use the information in the tables below to determine the most probable number of bacteria per 100 mL…

A: Given  Number of positive tube  0.1 ml = 4  0.01 ml = 1  0.001 ml = 0

Q: Branch, clade and monophyletic group are perfectly synonymous. Select one: True or False

A: Introduction :  A phylogenetic tree is a visual representation of the evolutionary connections…

Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…

A: Principle of parsimony: The principle of parsimony is made use of when we need to determine which…

Q: How understanding fish physiology be helpful in marine conservation and fisheries?

A: The term physiology relates to the study of mechanisms or functioning of cells, tissues or organs of…

Q: Do you think one species’ adapting over time to feed specifically and extremely successfully on…

A: Coevolution is a multifaceted, intricate process. It can manifest in interactions among closely…

Q: What is a wet mount technique in microscopy?

A: Microscopy is the technical field of using microscopes to view samples and objects that the naked…

Q: Which of the following helped to lay the groundwork for understanding the record of historical…

A: The Earth was created by deposition from the solar nebula approximately 4.54 billion years ago,…

Q: The diagram represents a possible phylogenetic tree showing the relationship between the four…

A: The phylogenetic tree is the diagrammatic representation of the evolutionary relationship of the…

Q: Question 12 Which of the following are true about the properties of enzymes? (select all that apply)…

A: Enzymes are proteins that act as biological catalysts by accelerating chemical reactions.

Q: Which of the following statements reflect the difference between RNA and DNA? Multiple answers:…

A: Introduction  The process through which a gene's information is used to create a functioning gene…

Q: Three risk factors of cancer.

A: Introduction  A group of diseases known as cancer involve abnormal cell proliferation and have the…

Q: (1) What is the major difference between the conventional PCR and real time PCR (qPCR) in terms of…

A: Question. What is the major difference between the conventional PCR and real time PCR (qPCR) in…

Q: Discuss the effects of isotonic, hypotonic, and hypertonic environments on red blood cells and plant…

A: Osmosis is the net movement of water across a semipermeable membrane.

Q: what is laboratory report?

A: what is laboratory report?

Q: What are cellular membranes mostly made out of? Choose the best answer. O Lipids and proteins O…

A: Introduction :- All cells have a cell membrane, also known as a plasma membrane, which separates the…

Q: Discuss the different methods of measuring onions and citrus physical characteristics/properties and…

A: Onion and lemon are two of the most important agricultural product in the globe. These two also fall…

Q: Explain how Alexander Fleming's discovery of the first antibiotic (Penicillin) made an impact on…

A: Introduction: The Scottish researcher Sir Alexander Fleming is credited with discovering penicillin…

Q: Compare the prokaryotic and eukaryotic cell process in detail. Protein Production Transport of…

A: Introduction  A prokaryotic cell was the first type of life to exist on Earth. Prokaryotic cells…

Q: Identify gene 1( bl, pr, vg) Identity gene 2 ( bl, pr, vg) Identify gene 3 ( bl, pr, vg)

A: The data is given for three point test cross. The three genes are involved in this case. These genes…

Q: Why does the genomic DNA precipitate upon neutralization, but plasmid DNA does not ?

A: The plasmid is the circular and extrachromosomal DNA present in prokaryotes. The plasmid harbours…

Sexual Motivation

Sexual motivation refers to a person's overall desire for sexual activity. It is an unusual motivation. Generally, among lower animals, the term 'drive' is commonly referred to as sexual motivation. It means a certain internal force drags the animal to be involved in reproductive behavior. On the contrary, humans are not simply driven by any internal force; rather, the sexual motivation in humans is due to several factors such as biological (hormones, genes), environmental (familial upbringing, chemical exposure) and physiological factors (culture, desire) which further determine engagement in sexual activities.