Question

What historical, social, religious, cultural, and economic factors
promote genetic drift in humans? Can you think of some specific
human groups in which genetic drift is likely to have occurred?

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Genetics

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom ...

A: The process of protein synthesis using the information in an organism's DNA is called central dogma ...

Q: What three molecules are released by NK cells to destroy an infected or cancerous cell?

A: Natural killers cells are a type of lymphocytes present in the blood circulation and form a componen...

Q: How will treatment for the second tuberculosis infection likely differ from the first round

A:     Tuberculosis is a serious disease caused by the bacteria Mycobacterium tuberculosis that mainly ...

Q: Explain how mistakes in meiosis impact sexual reproduction, normal development, and phenotype of off...

A: Meiosis is a kind of reductional cell division that forms gametes during sexual reproduction. 

Q: What is Differences Between Prokaryotes and Eukaryotes in the Details of Gene Expression?

A: Gene expression means genes express its function like DNA carry information can be express as protei...

Q: A nitrogen atom has 7 protons, and the most commonisotope of nitrogen has 7 neutrons. A radioactive ...

A: Isotopes are the atoms of same element having same atomic number but different mass numbers. For exa...

Q: What is Structure and expression of a typicaleukaryotic gene?

A: Gene expression is a complex process that is mediated by several processes. There are around 20,000 ...

Q: Given: For urea, the rate of excretion equals to the GFR times the urea concentration in plasma. (A)...

A: Given that – Urea concentration in plasma – 4.5 mmol/l Excretion rate – 450 mmol/day To calculate – ...

Q: Which of the following statements regarding congestive heart failure is correct? Group of answer cho...

A: Congestive heart failure (CHF) is a condition when muscles of the heart are affected to pump the blo...

Q: Please briefly state the importance of each stage of viral replication. Do not just restate what eac...

A: The process by which viruses are formed in host cells during the infection process is known as viral...

Q: Which product of apiculture is used in cosmetics and polishes?

A: Apiculture is the cultivation of bees for commercial production of honey.

Q: Mitral valve prolapse is a disease where the valve between the left atrium and left ventricle doesn’...

A: The mitral valve permits blood to flow from the left atrium into the left ventricle, but not in the ...

Q: Ribon enzymes are: a) catalysts for RNA splicing b)ribosomes which catalyze reactions c) the most co...

A: The word ribon enzyme mentioned here in the question must be ribozymes. Ribozymes are the RNA molecu...

Q: Describe the key steps of translation

A: Translation is the process of polymerization of amino acids to form a polypeptide. The order and seq...

Q: the compositions of esophagus and lung tissue by comparing their density when placed in water.

A: The oesophagus is a muscular tube that rapidly propels the food from pharynx into the stomach. It is...

Q: How gene expression is controlled and how itrespond to different environmental anddevelopmental cues...

A: The genes are the components of the genome that direct specific functions in the cell. Their express...

Q: some bodies of water, like the Dead Sea, have considerably higher salt concentrations than those of ...

A: The Dead Sea is termed as the dead sea because it has a high concentration of salt. It cannot suppor...

Q: The frequency of allele A in a population is 0.8 and the frequency ofallele a is 0.2. If the populat...

A: The Hardy-Weinberg equilibium, which is also known as the panmictic equilibrium, was discovered at t...

Q: What position do you take on the matter of language acquisition, and based on that position, would y...

A: Language acquisition is the process whereby children learn their native language. It consists of abs...

Q: How are the three main arthropod classes characterized according to the body division?

A: Arthropods are bilaterally symmetrical, jointed-leg (metamerism) invertebrates may be marine, fresh-...

Q: List three important ways in which your life would be different today if grassroots actions by U.S. ...

A: The three important ways in which your life would be different today if grassroots actions by U.S. c...

Q: Where does Tubular secretion occur in the nephron?

A: tubular secretion is the transfer of waste products from peri-tubular capillaries to the renal tubul...

Q: how can someone with diabetes mellitus lose weight?

A: Diabetes mellitus refers to a group of metabolic disorders in which the sugar level is high in the b...

Q: 15.3 Explain the fellovine diaeram: prospective nuclear protein nuclear Ran HYDROLYZES ITS BOUND GTP...

A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the...

Q: Both tetanus and botulism can cause major damage to the human body. Please discuss how both diseases...

A: Both tetanus and botulism are types of neurological diseases that can cause major damage to the huma...

Q: Voles (Microtus ochrogaster) were trapped in fields in southem Indiana and genotyped for a locus tha...

A: According to Hardy-Weinberg equilibrium, if there is no natural selection, mutation, gene flow, or g...

Q: A controlled experiment is one that(A) proceeds slowly enough that a scientist can make carefulrecor...

A: Generally, biologists and other scientists uses a scientific method with an observation. This result...

Q: In preparing a site for surface mining and later restoration, why wouldengineers separate the topsoi...

A: Restoration ecology is a branch of ecology that deals with the restoration of the degraded, damaged ...

Q: What amino acid residue of phosphoglucomutase is able to transfer the phosphoryl group to glucose 1-...

A: The glycogen’s phosphorolytic cleavage produce the glucose-1- phosphate and to enter the metabolism ...

Q: Distinguish between the hibernation and aestivation.

A: The importance of the sleep is mainly related to the conservation of energy of one’s body, survival ...

Q: Which of the following would be considered an example ofbioremediation?(A) adding nitrogen-fixing mi...

A: Bio remediation is the biological process in which organic waste materials are decomposed or degrade...

Q: BIO 211 Bacteriology Self Study: Use your text and lecture notes as reference to complete the table....

A: the cocci group of bacteria are found in close association with humans and animals. most of the bact...

Q: What are the biological troubles that molluscs face due to their soft body?

A: The second-largest phylum of invertebrates is Mollusca after Arthropoda. They are soft-bodied, tripl...

Q: Besides obesity, give the other two possible causes of OHS.   read the article “Obesity Hypoventilat...

A: The obesity hypoventilation syndrome is the breathing disorder of obese patients that leads to the d...

Q: how to best explain complications due to diabetes mellitus?

A: When the sugar level in the blood is high, it can seriously damage the different parts of the body e...

Q: How does a sandwhich digest? (in order)

A: Process of digestion: The processes of digestion takes place in the six stages they are: 1.Ingestion...

Q: Which of the following statements is correct? Group of answer choices Veins carry blood away from th...

A: Veins  Veins are blood vessels that carry blood towards the heart. Stenotic heart valve Valve that...

Q: WHAT IF? In humans, iron is a trace element requiredfor the proper functioning of hemoglobin, the mo...

A: The iron deficiency or sideropaenia is the condition in which the body lacks enough iron to supply i...