What is a carcinoma in situ (CIS)? Edit View Insert Format Tools Table 12pt v Paragraph v d to search in

Q: Your pregnant neighbor has been prescribed a daily dose of oral tetracycline for acne. Do you think…

A: Antibiotic are the medications prescribed to the patient against bacterial viral and protozoal…

Q: Can you help me the name of the labels?

A: Axon is a part of the neuron, which is a structural and functional unit of the nervous system. Axon…

Q: You are providing care to a victim  who sustained a laceration  to his left leg. The victim  should…

A: Stitches, It mainly used to close the wound, thereby it helps in wound healing.

Q: ne struct photomicrographs tumen, mucosa, submueosa Jumen adventitla Submucusa -cartilage mucsa

A: Trachea wall layers :  Lumen  Mucosa  Submucosa  Hyaline cartilage  Adventitia

Q: Fingerprint impressions that are not readily visible arecalled ___________.

A: Introduction: A fingerprint is a mark created by the friction ridges on a human finger. The…

Q: B A E D N F MIIC M K

A: Introduction: A group of genes that code for proteins found on the surfaces of cells that help the…

Q: Fill in the Punnett Square below. The first box is done for you. b b bb B

A: Punnet square is a square representation in which gametes from parent genotype are present on the…

Q: Fill in the Punnett Square below. The first box is done for you. b bb B.

A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…

Q: Pathogens and Infections. Use the topic and relate the topic for initiation progression and…

A: Invasive ductal carcinoma (IDC) is considered the most common form of breast cancer that occurs in…

Q: tatus: * Question Completion Which letter in the figure represents phlanges? O A. A O B. B OC.C O…

A: The letter D depicting the body part is the phalanges. Phalanges are the bones that constitute the…

Q: Why was half of each plate covered with an index card?

A: UV stands for ultraviolet rays. They are electromagnetic radiation. Ultraviolet radiation mainly…

Q: Sequence dideoxy sequencing

A: Sequence dideoxy sequencing is also called Sanger sequencing.

Q: common household item that looks like the ovary and testes

A: Figs seeds hang in twos when they grow looks as  two testis in scrotum.

Q: Mixing Embalming Fluids  Mildred is 58 years old and died after falling down the stairs when she…

A: The process of preserving the dead bodies by treating them with a mixture of  chemicals is known as…

Q: 15 11

A: Spinal cord is a long, tubular structure of the nervous system. It arises from brainstem and extends…

Q: 2. 3.

A: Brain is the largest organ in the body, and coordinates most body activities. Each part of brain is…

Q: Which of the following tests helps in diagnosis of cancer ? Urine test Neuro Test Blood test Biopsy…

A: Cancer is an abnormal tissue growth and multiplication of normal cells. Cancer cell divide rapidly.…

Q: hypertrophic scar characterized by.9 overproduction of granulation tissue and scar but not extend…

A: Wound healing It is the natural process of restoring a structural and functional ability of injured…

Q: Simple but creative caption on a poster about noncommunicable diseases caused by having unhealthy…

A: A non-communicable disease (NCD) is a disease that is not transmitted  from one person to another.…

Q: The letters of the words are jumbled. Use the clue to figure out what the word is and write them on…

A: In this question asked about the jumbled words. Detailed solution in step 2.

Q: What will pose an ethical issue in these procedures are performed - mutilation?

A: Mutilation- : Mutilation refers to eliminating or amputating any body part from the body. Female…

Q: write the full form of LINEs

A: The transposons are the segments of genes that are capable of moving from one position to another…

Q: Body Covering: DNA: GGGAGTGTATACGGGATGAAGGCGATT MRNA: 12 protein: phenotype:

A: To make proteins transcription happen, which mean DNA(genes)>copy of gene>protein, this is the…

Q: B- D. F LEICASE G H I J

A: A compound light microscope is a microscope with more than one lens and its own light source.

Q: short description about gloves for health workers.

A: Gloves are personal protective equipment used by health care giver while medical or any surgical…

Q: ake table to differentiate ITP, TTP, HIT, DIC.

A: Platelets They are also known as thrombocytes, and they are crucial to the process of hemostasis.…

Q: what is the lung cancer sample collection

A: Introduction Cancer is a lifestyle disease which can be caused by abnormal or unhealthy lifestyle…

Q: What type of chicken is this

A: The chickens are domesticated fowl belonging to subspecies of the red junglefowl. Chickens are…

Q: Presentation: 32 year old male presents with four genital lesions which he states have been present…

A: Genital herpes is one of the most common sexually transmitted infections in male and females due to…

Q: What is the most commonly used technique in making sections in histology

A: The study of cells, tissues and organs by identifying them under microscope is called histology. The…

Q: According to the book Crawford, Dorothy H. Viruses:  A Very Short Introduction, did the author…

A: Yes,Author Dorothy H.writes the book excellent ,that includes all the information related to virus…

Q: Choose incorrect statement about X rays OPTIONS X ray mainly used to look at the bones and joints…

A: X-rays are a type of radiation called electromagnetic waves that are used to create images of bone…

Q: Why is it necessary for pregnant women to strengthen their “pelvic floor”?

A: Pelvic floor is a muscular floor located at the bottom of the abdomen that stretches from the…

Q: A percutaneous is performed to treat osteoporosis-related compressionfractures.diskectomy…

A: Osteoporosis- Osteoporosis is a condition in which bones become weak and brittle due to that there…

Q: HgA HgB HgA HqB

A: Punnett square was named after Reginald C. Punnett. It is a diagram used to predict the genotypes of…

Q: Defend the statement "The investigations of Anthony Van Leeuwenhoek changes the world forever"

A: Antonie van Leeuwenhoek was a Dutch microbiologist who was born on October 24, 1632, in Delft,…

Q: The term ____ describes the ability of cancer cells to spread to other areas of the body. Group of…

A: When cancer cells break away from a tumor, they can travel to other parts of the body through the…

Q: Rosita Sanchez is 2 months pregnant, and she and her doctor are worried because her rash was…

A: Pregnancy is the process by which offspring is developed. there can be multiple pregnancy also mean…

Q: Steps or measures in order to see a bacteria under a microscope clearly

A: Bacteria are generally small unicellular prokaryotic organisms found in every environmental…

Q: pox, then add the text to the box and click Save'and Close.) edu gear (100

A: Thank you for the question  Answer = A cell is a cytoplasmic mass that is enclosed by a cell…

Q: Identify the picture

A: A red swath of blood flowing from the cut to your heart. On the end, a pimple or a yellowish crust.…

Q: Discussion : Alfred Hershey and Martha Chase . INTRODUCTION (Topic): Who is the topic of discussion…

A: ALFRED HERSHEY was an AMERICAN bacteriologist and geneticist born in 1908. MARTHA COWELES CHASE was…

Q: this is a Skin

A: The skin is composed of two main layers: the epidermis, made of closely packed epithelial cells, and…

Q: Modified true or false. Write the correct answer if the underlined word is false.

A: Any organic molecule that consists of a basic amino group, an acidic carboxyl group, and a distinct…

Q: Write an essay about "Human and Human Body"?

A: Human beings are anatomically comparable and identified with the great apes yet are different by…