Question

what is the highest pH level?

Expert Answer

1 Rating

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Biochemistry

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Naza th Coun Ce x Pych Eany e Theo Q Week Q A&P Exerc Q com/coursehtmlfcourseld 158577198HeplDd68ed0...

A: The "integumentary system" is one of the organ systems that consists of the skin, nails, hair, and e...

Q: What is the decription of gas exchange by the root system?

A: Oxygen from the air in the spaces between soil particles diffuse into the root hair and arrive to al...

Q: 3) You have identified an interesting mutant in gene P. Using a Punnett square, demonstrate the cros...

A: The pure breeding lines of mutant and wild type organism must be crossed to determine if the mutatio...

Q: Insulin,    a hormone    release in large    part due to carbohydrate    consumption and subsequent ...

A: Insulin is an essential hormone produced by beta cells of pancreatic islets. The insulin controls th...

Q: 17) There is a hypothetical gene in mice that produces a substance that induces twitchiness in hind ...

A: Here, it is given that female mouse of a true-breeding twitchy strain is mated with a male of a true...

Q: How does RNAi get around the problem of low rates of recombination?

A: RNAi or RNA interference takes place in all eukaryotes as a method of cellular defense. This method ...

Q: Which types of cells are capable of phagocytosis?

A: Phagocytosis is the process by which a cell uses its plasma membrane to engulf a large particle, giv...

Q: What is the function of Estrogen?

A: Hormones are chemical substances that help to control and maintain body growth and activity. Testost...

Q: These questions have more to do with animal biology. What is tail docking in general? and then what ...

A: Tail docking:Tail docking refers to the amputation or removal of a portion of animal’s tail, commonl...

Q: Can you do questions 12,13 and 14

A: Hello. Since you have posted multiple questions, we will solve the first question that is question n...

Q: 11) Draw a bacterial expression vector with all required vector sequences. Be sure to label any spec...

A: Bacterial expression vectors are used to introduce foreign genetic material into a host in order to ...

Q: IN a Hardy-Weinberg equilibrium, as the frequencies of homozygous genotypes increase, the frequency ...

A: According to the Hardy-Weinberg equilibrium, the frequencies of the alleles and genotypes in a popul...

Q: what is the normal temperature for a chicken?

A: Click to see the answer

Q: Describe the organization of a typical eukaryote gene.

A: The structural and functional unit for hereditary in a cell is the gene. Genes are composed of DNA s...

Q: 14) Do the cDNA libraries generated from a mouse brain and a mouse liver contain ALL of the same DNA...

A: A eukaryotic gene consists of coding (exons) as well as non-coding (introns) regions. During the tra...

Q: The Gardasil 9 vaccine prevents infection by all types of human papillomaviruses. True or False

A: The given statement is false.Human papillomaviruses (HPV) cause sexually transmitted diseases that c...

Q: Help for question 5

A: Given:At rest, the left ventricle of the heart pumps 5000ml of blood per minute and the renal blood ...

Q: How/Why do people dock tails in horses? and what does the procedure entail? and what are the health ...

A: Tail docking is the amputation of the tail. The reason why people dock the tail of horses is to keep...

Q: How does tail docking affective the stress level and overall behavior in horses? or is there no chan...

A: During docking process, horses experience an acute pain due to which they show some changes in handl...

Q: Table 2: Effect of pH on Enzyme Activity   pH Absorbance 2 0.05 4 0.35 6 0.8...

A: The point where the enzyme is most active is called the optimum pH. At higher or lower pH, enzyme ac...

Q: Cortisol - For the hormone Cortisol (in humans) what is; 1. the origin (gland that secretes the horm...

A: Hormones are chemical messengers or signaling molecules that are produced by the ductless glands and...

Q: Anthocyanin is a pigment that gives flowers and leaves purple colors. The M gene codes for a transcr...

A: 1)   In the question it is given that anthocyanin is the pigment responsible for expression of purpl...

Q: Which enzyme will be produced in a cell where a nonsense mutation is present in the lac operon?

A: Nonsense mutation is a kind of point mutation in which a stop codon will get introduced at the site ...

Q: explain in quantitative terms the circumstances under which the following reaction can porceed; L-ma...

A: Click to see the answer

Q: 13) What is the purpose of the negative selectable marker in a mouse knock out cassette?  a) Why don...

A: There are three types of selectable markers used in molecular biology, positive selection marker, ne...

Q: State the function of homeotic genes. Describe how nurse cells in fruit flies can affect larval deve...

A: Drosophila or fruit fly is taken as a model organism in genetic studies because of its less number o...

Q: Within a population of butterflies, the color brown (B) is dominant over the color white (b). And, 4...

A: According to the Hardy-Weinberg equilibrium, the frequencies of the alleles and genotypes in a popul...

Q: Describe the movements of chromosomes and the status of microtubule spindle during interphase, proph...

A: Interphase – During interphase, the chromatin gets decondensed inside the nucleus, due to which chro...

Q: What are the pros and cons of tail docking in dogs? please list more than one and be specific

A: Tail docking refers to removal of the portion of a dog’s tail through surgical means. This is usuall...

Q: Define photosynthesis

A: Click to see the answer

Q: What is a telomere problem and how is telomerase useful in this context?

A: Telomere is the sequence of repetitive nucleotides present at the ends of the chromosomes. Telomeres...

Q: An epitope associates with which part of an antigen receptor or antibody? The tail The heavy-chain ...

A: Click to see the answer

Q: Process by cell membrane that take in fluids and dissolve substances

A: The movements of ions and molecules in and across the cell membrane are regulated by a set of transp...

Q: You are trying to determine the base content for a number of samples in the lab (mouse DNA, bacteria...

A: A nitrogenous base is an organic compound that has properties of a base and a nitrogen atom. It is i...

Q: (Physiology)  Nurse Emma measured out 5 grams of potassium chloride (KCL). Using dimensional analysi...

A: In chemistry, mole is the unit to tell the amount of a substance. A mole is defined as the substance...

Q: Identify the causative agent of staphylococcal food poisoning and explain the method for transmissio...

A: Food poisoning is the illness that occurs due to consumption of food that has lost its quality of du...

Q: Identify why it is important to study human diseases.

A: Click to see the answer

Q: T4 - For the hormone T4 (in humans) what is; 1. the origin (gland that secretes the hormone) 2. acti...

A: 1.   The Origin of T4 hormone- It is secreted by the thyroid gland. Thyroid gland is a bilobed endoc...

Q: In a non-evolving population of wildflowers, there are 452 individuals with serrated leaves and ther...

A: For every gene, there will be two alleles. One is dominant and the other is recessive and these two ...

Q: explain the perneability of the descending and ascending limbs of nephron loop to water and NaCI.  h...

A: The loop of Henle of a nephron is divided into thick and thin ascending and thin descending loops. I...

Q: What are the differences between bacteria and viruses?

A: The differences between bacteria and viruses are as follows:Bacteria are cellular organisms whereas ...

Q: Can you please answer 32

A: Any alteration in the genome’s nucleotide sequence is called a mutation. It may involve small-scale ...

Q: 6) How does RNAi maintain the heterochromatin at the centromeres of chromosomes?

A: Chromosomes are long thread like structures present in the nucleus of all the cells. Centromeres are...

Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dn...

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If y...

Q: what is the direction of urine movement in the kidney?

A: Kidneys are paired structure that is present on either side of the ribs in the retroperitoneal space...

Q: Let’s    presume   that a   single hormone    is responsible for    the feeling of sleepiness    to ...

A: The correct answer is steroid hormone.The steroid and peptide hormones differ in various aspects lik...

Q: Why are anatomy and physiology studied together?

A: Anatomy, histology, physiology, and embryology are the branch of science that deals with the human b...

Q: Can you please label the skull

A: A skull is a bony structure that is composed of cranium and facial bones. The composition and the sh...

Q: The acromial region is ________________ to the otic region. (medial or lateral)

A: The acromial region is the location where shoulder bones are present.Otic region present in skull ar...

Q: Is it likely that a pure culture could be isolated from the human body? Why or why not?

A: In microbiology the pure culture is a laboratory culture that contains a single species of organism....