What purpose was served by filtering the milk sample after the addition of acid?
Q: Explain the process of Drug Elimination
A: Drug elimination is the removal of drug from the body.
Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…
A: Given P1(Parent 1)= Round Shape(T) Yellow Colour (Y) P2(Parent 2)= Wrinkled Shape(t) Green Colour…
Q: (8) B-ketothiolase is a multifunctional enzyme in lipid catabolism. Which of the following is NOT…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…
A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…
Q: Explain the mechanism of Warburg effect and how it benefits cancer cells
A: Cancer means uncontrolled cell growth. This uncontrolled cell growth may cause a lump of cell or…
Q: Question 4 Match the following descriptions to the given choices v Synthesized from a steroid…
A: Vitamins are essential nutrients that are important for the protection of body from diseases.…
Q: Explain what Hepatocyte hopping is
A: Introduction: The liver is the modified exocrine gland and liver cells are made up of hepatocytes.…
Q: Procedure: 1. Dissolve one teaspoon or one packet of active yeast in a small amount of warm water.…
A: Hi, thanks a lot for submitting multiple questions and as you have asked to answer 5, 6 and 7…
Q: HN- CH H2N-CH-c-OH HaN — сн—с— он | Н-N— сн—с—он CH2 CH2 ČH2 CH2 CH2 CH2 NH2 ÓH A B D H2N-CH-C. -ОН…
A: Aminoacids are the building blocks of proteins. They have two functional groups along with side…
Q: Does the change Glu®Val (Eb6V) explain the unequal migration of HbA and HbS in your gel?
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Hormones, such as testosterone, estradiol and progesterone are examples of steroidal lipids. O True…
A: Leydig cells secrets testosterone in male body. In female body ,granulose cells of the ovaries…
Q: Consider the beta oxidation of stearic acid (C18:0): How many ATP are generated in complete…
A: Stearic acid has 18 C so 8 cycles are involved in its beta oxidation, One cycle yield 1 FADH2 and 1…
Q: How is a “committed step” defined in the context of a metabolic pathway and why are they important?…
A: A metabolic pathway is a chain of biochemical reactions linked together by their intermediates.…
Q: of Mg2+.Classify each analyte based on its level in the soil sample
A: Amount of soil sample = 2.65g In mg = 2.65 × 1000 = 2650…
Q: Which statement is correct about expression of a gene regulated by Gal4? O Galactose increases gene…
A: In yeast the transcriptional activator GAL4 binds to the upstream activating sequence of the gal…
Q: Time left 1:48 37 Please describe the digestion process of proteins in the whole digestive system.…
A: In process of digestion, complex molecules are converted to simple molecules with the…
Q: Diagram to compare & contrast CATABOLISM vs ANABOLISM such as its process/mechanism, relation with…
A: Anabolism and Catabolism are the two broad type of biochemical reaction in metabolism where…
Q: Insulin is a hormone that regulates the glucose level in the blood. Today, human insulin with this…
A: Insulin is a pancreatic hormone that stimulates the transport of glucose from blood to muscles and…
Q: Which amino acid(s) are more commonly found at the At which position(s) are amino acids limited to…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Three [BIOMOLECULES] Instructions; — Answer the questions properly. — Do not copy in Google or…
A: Fatty acids are hydrocarbon chains with a carboxylic acid group. Fatty acids are classified as…
Q: Which of the following processes generates the most ATP? (Account for the no. of ATP) a. ) Citric…
A: The human body is a complex system that requires energy to operate effectively. At the cellular…
Q: 1. What are the major functions of lipids?
A: Introduction: Lipids are a heterogeneous group of biological compounds which includes fats, oils,…
Q: Genetically modifying seeds to produce herbicide-resistant plants that increase crop yields has…
A: A Genetically modified technology is formed of insertion of a DNA into the genome of an organism.…
Q: 10. Isoniazid (MAO inhibitor) is prescribed to the patient with Parkinson discase. What does cause…
A: Parkinson's disease is commonly seen in adults after the age of 50. Parkinson's disease is known to…
Q: residues listed below: (a) Ser195 (b) His57 (c) NH groups of Gly193 and Ser195
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3…
Q: (continued) B. From a metabolic engineering perspective, why did the researchers heterologously…
A: Zymomonas mobilis is a gram negative facultative anaerobic bacteria. It ferments the pyruvate into…
Q: Arginine is considered a basic amino acid because its side chain ________ at physiological…
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…
Q: Significance of proteins in CSF and how to determine the cerebrospinal fluid analysis protein.
A: Protein, like the enzymes, blood, and cerebrospinal fluid, may be found in practically all human…
Q: 2. Complete and identify the enzymes involved in the following pathways OydroyacetoreP tructose…
A: The glycolytic pathway helps to metabolize glucose molecules obtained through the diet, glycogen…
Q: Illustrate and summarize ketogenesis.
A: Ketogenesis is one of the biochemical pathways. The process of ketogenesis occurs in the liver. The…
Q: 12. You can distinguish epinephrine hydrotartrate from norepinephrine hydrotartrate by: A. Water…
A: Hi, thanks a lot for submitting the multiple questions. As we are allowed to answer one question at…
Q: Morphine (give structure) and enkephelin (give structure) both are antagonists of the m opioid…
A: Morphine is pain medication which is used in Treatment of pain.this is belongs to opiate family.…
Q: Biochemistry: Diagram the biosynthetic pathway from precursors (like amino acids, PRPP, etc.) to…
A: There are two pathways for the biosynthesis of nucleotides: de novo and the salvage pathways. In the…
Q: Why is it difficult to accurately estimate Km and Vmax values from a Michaelis-Menten plot…
A: The rate of enzyme catalyzed reaction that is the enzyme kinetics can be expressed by the…
Q: When phospholipids are dispersed in an aqueous solution, they will often form more ordered…
A: The phospholipids are the principle constituents of the cell membrane.
Q: Why egg whites and milks are used as antidotes for heavy metal poisoning?
A: Heavy metal poisoning is a process in which an organism is exposed to excessive amount of heavy…
Q: Why are they so designated? Ketone bodies are so named because they contain the ketone functional…
A: Ketone bodies are produced by the liver during caloric restriction.
Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エ エ 工王 \\
A: Retention factor The amount which each component of a mixture travels can be easily quantified using…
Q: Proteins called molecular chaperones assist in the process of protein folding. One class of…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: Competitive inhibitors are: Select one: O a. bind to another part b. causing the enzyme t bind to…
A: Inhibitors are molecules that bind to enzyme and block it's activity. Enzymes inhibitors are…
Q: A. They carry unneeded cholesterol back to the body's liver, where it is eliminated. 7. Which…
A: Lipids are amphipathic molecules that contain both polar and non-polar parts present in them. Lipids…
Q: Draw the two amino acids serine and alanine, and a dipeptide that could be formed by combining these…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: What types of monomers make up a carbohydrate? What are carbohydrate polymers called?
A: Carbohydrates are biomolecules made up of carbon, hydrogen, and oxygen. The ratio of H and O is the…
Q: n the discovery of new drugs, the chemical and physical properties of a molecule are very important…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: True or False? It takes Carbon dioxide and water in the presence of sunlight to produce…
A: Carbohydrates are formed in green plants by the process of photosynthesis.
Q: Carbon monoxide is lethal at low concentrations yet it plays an important role in cell signalling…
A: During the breakdown of heme, carbon monoxide (CO) is continually created in mammalian cells. CO is…
Q: Fill out the table below. Determine whether the rate of the metabolic pathways will increase or…
A: Regulation of blood glucose is largely done by endocrine hormones , through a negetive feedback…
Q: How to calculate the amount of myoglobin in grams from a 2.0 ml sample of protein extract???
A: Beer Lamberts law states that value of Absorption at a particular wavelength of light by an analyte…
Q: POST-LAB QUESTIONS 1. When a reducing sugar reacts with Benedict reagent, what organic product is…
A: 1. The Benedicts reaction with reducing sugar is given below. Reducing sugars can be either in…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Why should the specimen be albumin free when performing the chloride test for urine?If the test method used in the laboratory varied from the specification, how will it affect the results? What factors contributed to possible errors in laboratory results?The outer surface of the product container was not disinfected. effect: rationale: