What will happen if both SRP54 and SRalpha are bound toGTPgammaS instead of GTP?SRP54 and SRalpha will always bind to the sec61 translocon, andribosome will fail to translate proteins into the ER lumenSRP54 will never bind to SRP receptor, and ribosome will alwaystranslate proteins into the ER lumenSRP54 and SRalpha will always bind to the sec61 translocon, andribosome will always translate proteins into the ER lumenSRP54 will never bind to SRP receptor, and ribosome will fail to translateproteins into the ER lumen

SRP54 and SRalpha are proteins involved in the process of protein synthesis and folding in the…

Answered: What will happen if both SRP54 and…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 15P

See similar textbooks

Similar questions

Searching the yeast Saccharomyces cerevisiae genome, researchers found approximately 4,000 DNA sites with a sequence which could potentially bind the yeast transcription factor GAL4. GAL4 activates the transcription of galactose genes. Yet there are only 10 GAL4-binding sites which control the genes necessary for galactose metabolism. The GAL4 binding sequence is CGGAT#AGAAGC*GCCG, where # is T, C or G, and * is C or T. In one chromatin immunoprecipitation experiment (ChIP), yeast growing on galactose were lysed, and subjected to cross-linking reagents which cross-linked transcription factors and activators to DNA. Next the DNA was sheared into small fragments, and antibodies to GAL4 were added. These antibodies coprecipitated the GAL4 and the DNA it was cross-linked to. The cross-linking was then chemically reversed, and the DNA was isolated, cloned into a library of plasmids and sequenced. Results showed that only 10 different DNA sequences had GAL4 bound. Since the…
List the type, location (ex. C-terminus), and key feature (stretch of certain type of amino acids) for the sorting signal sequences you predict be present on GFP construct that allows it to end up in the organelle specified. If none, please note: a. GFP as a soluble lysosomal resident b. GFP ends up in the chloroplast stroma c. GFP ends up in the nucleus d. GFP is localized to the plasma membrane, with 3 transmembrane domains, and its N-terminus in the cytosol
A rare mutation can result in eukaryotic cells that causes a failure in the cell to synthesize the Signal Recognition Particle (SRP). Failure to make the SRP would impact protein synthesis by ________ . A. Preventing transition of bound ribosomes to free ribosomes B. Preventing binding of ribosomes to the rough ER during synthesis of proteins with a signal sequence C. Preventing export of mRNA out of the nuclear envelope D. Preventing binding of ribosomes to the smooth ER during synthesis of proteins with a signal sequence
Notch is an important transmembrane receptor that is present on the plasma membrane. Curiously, it possesses a proteolytic cleavage site and an NLS in its intracellular domain. In a protein fragment complementation experiment the Notch receptor was fused to the N-terminal portion of GFP on its intracellular domain. Another protein that is known to act in the nucleus to mediate the Notch signal following its activation was fused to the C-terminal region of GFP. When both are expressed in the same cell, GFP is observed in the nucleus. In 3-4 sentences provide an explanation that would account for the expression of GFP exclusively in the nucleus.
When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced.Gcn4 translation however is increased.what would happen under high and lowamino acid conditions if only one of the upstream ORFs were deleted from Gcn4?
A human gene called theCFTR gene (for cystic fibrosis transmembrane regulator) encodes aprotein that functions in the transport of chloride ions across the cellmembrane. Most people have two copies of a functional CFTR geneand do not have cystic fibrosis. However, a mutant version of the CFTRgene is found in some people. If a person has two mutant copies ofthe gene, he or she develops the disease known as cystic fibrosis. Arethe following descriptions of this disease related to genetics at themolecular, cellular, organism, or population level?A. People with cystic fibrosis have lung problems due to a buildupof thick mucus in their lungs.B. The mutant CFTR gene encodes a defective chloride transporter.C. A defect in the chloride transporter causes a salt imbalance inlung cells.D. Scientists have wondered why the mutant CFTR gene is relativelycommon. In fact, it is the most common mutant gene that causesa severe disease in persons of Northern European descent. Onepossible explanation why…
What would most likely occur to nuclear-cytoplasmic shuttling if the intrinsic GTPase activity of RAN was slowed down by 50%? Group of answer choices RAN would not bind exportin and proteins would accumulate in the nucleus All of the answers are likely None of the answers are likely Importin beta would not release from RAN in the cytoplasm and nuclear import would slow down RAN would not bind to importin beta and protein cargo in the nucleus would not release
Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
What mechanistic features are shared by (a) the formation of multivesicular endosomes by budding into the interior of an endosome and (b) the outward budding of HIV virus at the cell surface? You wish to design a peptide inhibi- tor/competitor of HIV budding and decide to mimic a portion of the HIV Gag protein in a synthetic peptide. Which portion of the HIV Gag protein would be a logical choice? What normal cellular process might this inhibitor block?
Genetic testing of a 29-month-old boy shows a mutation in the Phe residue at position 508 in the cystic fibrosis transmembrane conductance regulator (CFTCR) gene. Cultured skin fibroblasts from the boy contain an abnormal form of CFTCR protein bound to ubiquitin. Which of the following structures is the most likely site of elimination of these abnormal proteins in this patient? A) Endoplasmic reticulum B) Endosome C) Golgi complex D) Lysosome E) Proteasome
You are researching the regulation of cell-size control and discover that a signaling pathway that acts through a particular enzyme-coupled receptor is important for the size growth (enlargement) of rat kidney cells. Receptor activation causes activation of adenylyl cyclase, which ultimately leads to the activation of PKA. PKA then phosphorylates a transcription factor called BTS on threonine 84. This phosphorylation is required to allow BTS to bind to specific regulatory DNA sequences, increasing the transcription of Zrt2, a gene encoding a protein vital for kidney cell growth. You find that kidney cells without this receptor are 25% smaller than normal cells. When you measure cells expressing a constitutively active version of PKA, you find they are 25% bigger than normal kidney cells. Based on these results, predict whether a kidney cell’s size would be bigger or smaller than normal kidney cells in each of the following circumstances. Explain why in 1-2 sentences for each. You…

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS