Question

What would be an example of an everyday respiratory event that both inhalation and exhalation are considered active processes (simulated by the Forced Vital Capacity (FVC) button)?

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Animal Physiology and Biochemistry

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Given the following values, calculate the fluid movement between capillaries and tissues: hydrostati...

A: capillaries are permeable to fluid excahnge between the intra- and extravascular compartments of the...

Q: Give a suitable example for commensalism.

A: The five basic types of interactions among species that have been identified by ecologists are paras...

Q: What assumptions must be met for a population to be in Hardy–Weinberg equilibrium?

A: Accordingly to Hardy-Weinberg principle, the allele and genotype frequencies remain constant when th...

Q: What is the embryonic characteristic that evolutionarily makes echinoderms proximal to chordates?

A: Echinoderms are marine invertebrate deuterostomes that occupy inter tidal zones of the ocean. They s...

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom ...

A: Transcription is the first step of central dogma or simply gene expression in which the DNA sequence...

Q: What is apoptosis and how is it regulated?

A: The cell division and cell death work collaboratively to maintain the normal physiological functioni...

Q: Which type of capillary would you expect to find in the brain? Group of answer choices Continuous Fe...

A: Capillaries: Capillaries are small blood-containing structures that join ventricles and arterioles.C...

Q: Calculate how much the PCB concentration increased at each step in thefood web.

A: PCB or Polychlorinated biphenyls  PCBs are very stable mixtures that are resistant to extreme temper...

Q: Difference between green and white revolution?

A: The differences between green and white revolution are :-

Q: Why is inbreeding necessery in animal husbandary?

A: Animal husbandry is the process of agricultural practice of breeding and raising livestock. A breed ...

Q: How are the three main arthropod classes characterized according to the body division?

A: Arthropods are bilaterally symmetrical, jointed-leg (metamerism) invertebrates may be marine, fresh-...

Q: Give some example of breed and species?

A: A group of animals possessing similar general appearance, features, size, configuration, etc. are sa...

Q: What is the direction of Phosphorus ion movement?

A:         Two instances will be discussed in this answer. (1) direction of phosphorus ion movement dur...

Q: What position do you take on the matter of language acquisition, and based on that position, would y...

A: Language acquisition is the process whereby children learn their native language. It consists of abs...

Q: Give a short note on phytophagous animals with example.

A: 'Phyto' means plant and 'phagous' means eater. So, phytophagous means plant-eater.

Q: What are the three structures shared by every chordate that characterize the group?

A: Chordates are the animals under phylum Chordata. Phylum Chordata is included in kingdom Animalia.

Q: 2. Red blood cells are multinucleate in nature.a) Trueb) False

A: Multinucleate cells are the cells with multiple nucleus. Red blood cells (RBC) are red in colour due...

Q: Besides obesity, give the other two possible causes of OBS.                                 read the...

A: Hi! We don't answer questions using external references. Hence, I will be answering the question for...

Q: Explain how the body’s first line of defense protects us from potentially harmful organisms.

A: Immunity:our body has a defense mechanism that can be used to fight with external invasion of pathog...

Q: Describe blood flow through the heat. Begin at the superior and inferior vena cava and end at the as...

A: The circulatory system is one of the major systems of the human body. The circulatory system consist...

Q: What are The Effects of Mutations on Polypeptides?

A: The mutation is the alteration of DNA (deoxyribonucleic acid) that could occur due to change in one ...

Q: What is the pathway of the “filtrate?” Bowman’s Capsule è Urinary Bladder

A: The urinary system consists of the kidneys, ureters, bladder, and urethra. It eliminates waste from ...

Q: Why does the structure H¬C“C¬H fail to make sensechemically?

A: Every atom of an element consists of electrons, protons and neutrons where electrons are negatively ...

Q: HOW Ribosomes and Charged tRNAsCollaborate to Translate mRNAsinto Polypeptides?

A: The proteins perform a wide variety of the functions of a cell. The synthesis of proteins is one of ...

Q: Identify the four main threats to biodiversity and explainhow each damages diversity

A: Biodiversity:   It is variability and varieties of life on earth. It is a measure of variation at sp...

Q: What is diapause and its significance?

A: Diapause is observed in case of insect development.

Q: The mutation for drug resistance in Mycobacterium tuberculosis, the bacteria that causes the disease...

A: Drug resistance is defined as the phenomenon of reduced effectiveness of a drug against a pathogen. ...

Q: . Identify the theme or themes exemplified by (a) thesharp quills of a porcupine, (b) the developmen...

A: Biology is the scientific study of life and its related biological aspects. The interactions among l...

Q: When conducting the Triple Sugar Iron Test, what is the result of the bacteria Staphylococcus epider...

A: Triple Sugar Iron Agar test is a test which has three sugar (Lactose, Sucrose, and Glucose) and also...

Q: Which of the following statements is correct? Group of answer choices Veins carry blood away from th...

A: Veins  Veins are blood vessels that carry blood towards the heart. Stenotic heart valve Valve that...

Q: histology: Create the table in which you compare the structure of the walls and cell types of the sm...

A: The small intestine is a part of the alimentary canal located between the stomach and the large inte...

Q: What is the The structure of ribosomes?

A: The ribosomes are non-membranous structures found in the cytoplasm of the cell. They are the core or...

Q: As we have learned in this chapter, the Nanos protein inhibits the translation of hunchback mRNA, lo...

A: Drosophila or fruit fly is a common model organism for developmental biology. Nanos refers to a prot...

Q: WHAT IF? In what way is the Kissimmee River project a more complete ecological restoration than theM...

A: Biology is a branch of science that studies about the living organisms. The biology studies about th...

Q: Are mollusc metameric beings? Exclusively analyzing this feature could it be said that molluscs are ...

A: The mollusks are a diverse group containing 85,000 species. These are mostly marine species.

Q: What are some representatives of the phylum Mollusca?

A: Molluscs or mollusks are unsegmented, soft-bodied animals, with a body divided into a head, a muscul...

Q: What is the "cost" of synthesizing saturated fatty acid containing 12 carbons from acetyl-CoA in the...

A: Malonyl coenzyme formation is an essential step in the synthesis of fatty acids. At first acetyl, Co...

Q: what influences a child to play with a doll versus a truck, or what influences a child to engage in ...

A: There are various theory and model regarding child’s behavior. There is still debate among developme...

Q: What is RNA splicing?

A: RNA is a long chain of ribonucleotides connected together via phosphodiester bonds. It works in gene...

Q: Name 5 organisms that can carry out nitrification, write the chemical reaction, what enzyme carries ...

A: The nitrogen cycle is the biogeochemical cycle by which nitrogen is fixed and also recycled back to ...

Q: What are some qualities of tuberculosis that make occurrences of antibacterial resistance so prevale...

A: Tuberculosis is a bacterial disease that can infect other persons if the droplets put into the air d...

Q: Which of the following would be considered an example ofbioremediation?(A) adding nitrogen-fixing mi...

A: Bioremediation is a biological process in which organic waste materials are decomposed or degraded b...

Q: what is the role of ribosomes in protein synthesis

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It occu...

Q: In class we discussed 7 different types of diseases that can occur from Herpes Simplex Virus Type 1 ...

A: Since I am unaware of the diseases that have been discussed in your class, I will be answering this ...

Q: Name the two plant which are produced by micropropagation?

A: Micropropagation is a rapid vegetative proportion technique to increase the number of plants with ti...

Q: Semi-dwarf varieties of a crop plant ere derived fromIR-8 name that crop?

A: As name suggests, a dwarf variety refers to a plant that grows to a lesser height than usual for its...

Q: Explain the term posttranslational modifications?

A: Translation refer to the process in which synthesis of protein occurs from an mRNA molecule.

Q: List any four characters that are employed in human population census.

A: Population census is the counting the number of people in the territory of country and documenting i...

Q: Give short note on adaptations of desert plants and animals.

A: Desert is inhabited by animals like camel, Iguana, desert tortoises etc. It is inhabited by plants l...

Q: Sickle-cell hemoglobin (HbS) differs from normal human adult hemoglobin (HbA) by a single mutational...

A: Sickle cell anemia is a genetic disease where there is a single nucleotide mutation. This single nuc...