Which feature is typical of primary active transport?     The transport protein must cross to the correct side of the membrane before the solute can bind to it.     The transport protein is irreversibly phosphorylated as transport takes place.     The transport protein catalyzes the conversion of ADP to ATP.     The solute moves against the concentration gradient.     A concentration gradient provides the energy to move substances against their concentration gradient

Q: Complete concept map

A: The matter is any substance that occupies space, has a mass as well is observable.

Q: Describe the two possible versions of the traits for all of the characteristics you found in Pod…

A: Since you've asked multiple questions, we're answering the first three for you. If you want any…

Q: What is the purpose of control tubes in an experiment? a. To use up more tubes and look more…

A: The unknown sample is tested and compared to positive and negative controls to determine the test…

Q: If the lacZ protein breaks down lactose, is it worthwhile to make it when there is no lactose…

A: The prokaryotic gene regulatory system is known as operon system in which they regulates the…

Q: why does DNA breathing occur?

A: Introduction: DNA serves as the template and substrate for many important biological processes,…

Q: what is bone marrow as an hematopoietic organ

A: Mesenchymal and hematopoietic stem cells are found in bone marrow. Red bone marrow is a fragile,…

Q: What would be the result of the following?  the centromere is missing from a cell a chromosome…

A: Introduction  A chromosome is a lengthy DNA molecule that contains all or a portion of an organism's…

Q: ATP synthasederives energy for the generation of ATP from

A: ATP which is also known as Adenosine triphosphate. It is a source of energy which use and store at…

Q: 2. The hereunder template shall be used in enumerating the functions if the Digestive Organs: Organ…

A: Introduction: The gastrointestinal tract is a component of the human digestive system, along with…

Q: A. Let us see if you can help Draky, who traveled from home to his work using bicycle, but has been…

A: Introduction  An individual's blood is categorised according to their blood type based on the…

Q: 3) In the human brain, an estimated average rate of 250,000 nerve cells are produced each minute…

A: Brains are constructed on a solid foundation, just like a home. This begins before birth and is…

Q: What new connection/articulation is made by the tetrapod pelvic girdle, relative to fish? To which…

A: Introduction:- Fishes and tetrapods are categorised under the chordata because of the presence of…

Q: Describe the fluid compartments (ICF, ECF, blood and interstitial fluid) Describe the distribution…

A:

Q: Why is there a need to provide the magnification of a specimen drawn

A: Microscopy is used to visualise the objects such as tissues, cells, nanoparticles etc. which can not…

Q: How does bulk transport of molecules governed in a eukaryotic cell? by active transport by…

A: Bulk Transport Across Cell Membranes Bulk transport inwards as well as outwards occurs across the…

Q: The following are the conditions that determines the direction of ions as it pass through the…

A: There are different types of channels found in living systems. Their functioning is also different.…

Q: Where would you expect competitive exclusion to occur most quickly? (Choose the one best answer.)…

A:

Q: Which species is/are sympatric with Echinometra lucunter?

A: When two interrelated species or populations coexist in the same region and come into contact with…

Q: Using your calculated expected numbers and the following observed numbers for each progeny…

A: Chi-square (x2) analysis is a statistical test that is used to determine the acceptance or rejection…

Q: Which of the following pathways would you expect to be inhibited by drugs that prevent import of…

A: Explanation: Since the import of proteins into the nucleus is part of the TGF-Beta signalling…

Q: Wing Length for Ground Finches Observed in the Wet Seasons of 1973 and 1978 Wet 1973: all finches #…

A: The changes in finches beak size and wing length size are due to their adaptation in different…

Q: Which group (Population A that stayed in the flat territory or Population B that moved to the rocky…

A: Genes are the hereditary units that control specific traits, different versions of these genes are…

Q: Minimize pipette handling Questions : How important is it to transfer the proper liquids in their…

A: Pipette is a safe method by which small amount of liquid can be transferred from one location to the…

Q: Do all the phylogenetic trees below represent the same relationships (same topology)? If not, circle…

A: The phylogeny depicts the evolutionary relationship between taxons present in the phylogeny.

Q: Species interactions determine an organism's fundamental niche. True False

A:

Q: How does the streaking of plates help you obtain single colonies?

A: Microbial cultures can be grown in solid or liquid media. The solid media use a solidifying agent…

Q: What does “prezygotic” mean?

A: The processes of reproductive isolation are a group of behavioural patterns, physiological…

Q: give their taxonomic classification and describe their unique characteristics

A: Spiny lobsters live on reefs and in the mangrove swamps. Their diet is composed of mollusks, plants,…

Q: How do potassium ions travel as they move into the cell?A.Up the concentration gradient and up the…

A: Introduction The cell membrane is a structure that surrounds the cell and keeps the organelles…

Q: Suppose the prevalence of HIV is 0.3% in the population of 500,000 blood donors for your…

A: Below I am attaching a image pls go through it.

Q: 1a. What is the basic structure of a nucleosome? Also what's the key characteristics of histone…

A: Chromosome The highly condenced form of DNA chromatin fibres. These condensation is possible with…

Q: Where would you expect competitive exclusion to occur most quickly? (Choose the one best answer.)…

A: Competitive exclusion is one of the most important interactions in an ecological system where two…

Q: How many species are present at year 1000? Justify your answer (i.e., clearly explain your…

A: The term species can be defined as a group of individuals that are able to inbreed. Speciation is…

Q: Please answer fast a.) define each of the roles of muscles (agonist, antagonist, synerist) and…

A: We need muscles to perform our daily tasks. When we exercise, our muscles burn available food for…

Q: What do you predict will be the proportion of birds with beaks that are 11mm or longer in another…

A: Evolution is a process that involves a change in organisms due to the adaption of organisms in their…

Q: what properties of phospholipids allow spontaneous membrane formation and how they do it

A: According to bartleby guidelines, i can only do one question, kindly post the remaining question…

Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…

A: Cell membrane is made up of phospholipids and proteins and arranged in a fluid mosaic model. The…

Q: The _____________ plants died, partially decomposed, and became the fossil fuels? (choose all that…

A: Sphagnum Moss:  There are over 380 recognised species of mosses in the genus Sphagnum, which is also…

Q: The AMPA receptor is a and the NMDA receptor is a, a. transmitter-gated ion channel,…

A: AMPA receptors:- AMPA (α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate) receptors are a type of…

Q: An explanation of the testosterone hormone structure (the functional groups and everything) - How…

A: Testosterone is produced  by the interstitial cells of Leydig in testes in men. After secretion by…

Q: The following are the conditions that determines the direction of ions as it pass through the…

A: Transport channel  The channel by which the molecules are transported across the membrane.

Q: Which of the following statements is true about linkage disequilibrium?

A: LD or linkage disequilibrium is the non-random association of alleles from different loci. LE or…

Q: Two pea plants, each genotype TT, Tt Knowing that the allele of tall leg is T, allele short leg is…

A: Given  Allele  T - for tall  t - for short  T - dominant  t - recessive  Parent genotype and…

Q: Channel gating – Carrier-mediated transport

A: Channel Gating :  It is defined as the  process of encoding of biological signals as a change in…

Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…

A: Introduction  The term "membrane transport" refers to a group of systems that control the movement…

Q: Coral polyps and their symbiont zooxanthallae algae are an example of..... competition O facultative…

A: .Ecological relationships describe the interactions between and among organisms within their…

Q: If a goose with genotype Aa had migrated instead of the goose with genotype aa, would the scenario…

A: The movement of genes into or out of a population is referred to as gene flow. Such movement may…

Q: Which of the following statements is TRUE about phospholipids? The hydrophobic fatty acid tails on…

A: A phospholipid is a type of lipid molecule that is the main component of the cell membrane.

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: Answer the following questions: 1. What is the importance of capsule to a microoganism? 2. Why is…

A: Capsules are the outmost structures of bacterial and fungal cells.

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.