I need explanation for the why the answer is correct? And why would the other options wrong Which of the following is true of DNA repair?a) DNA repair can only repair single nucleotidechanges in the DNA sequence.b)DNA repair can be error-free or error-prone.c)DNA repair always relies on the sisterchromatid as a template to repair DNA.d)DNA repair always results in accurate repair ofchanges in the DNA sequence.

DNA repair is the process by which a cell identifies any damage in the DNA and rectifies it. It is…

Answered: Which of the following is true of DNA…

Science

Biology

Which of the following is true of DNA repair?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 23QP: How does DNA replication occur in a precise manner to ensure that identical genetic information is...

See similar textbooks

Related questions

Q: The inability of DNA polymerase to replicate the ends of linear chromosome in one strand, compare…

A: Introduction The biological process of producing two identical copies of DNA from a single original…

Q: DNA polymerases have a shape resembling a right hand with three functional domains. What are the…

A: The enzyme DNA polymerase is in charge of DNA replication. This enzyme's purpose is to split a…

Q: the role of DNA ligase I.

A: Answer. DNA ligases are the enzymes that are required by all organisms to sustain the structural…

Q: How can reverse transcriptase inhibitors slow the replication of DNA? Give an example that…

A: DNA, or deoxyribonucleic acid, is defined in the universal term that is a genetic substance found in…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: The function of enzyme involved in base excision repair isa) Addition of correct baseb) Addition of…

A: Reactive free radicals generated form various endogenous processes and environmental…

Q: Match the statement to the corresponding agent/key player in DNA replication. Some items require…

A: DNA replication is the biological process where a double-stranded DNA molecule is copied or…

Q: DNA ligases cannot join the sticky ends of two DNA fragments. True False

A: The DNA ligases are used in the process of cloning in which pieces of DNA having matching ends are…

Q: In light of your knowledge of DNA replication, discuss the following statement: "Only the DNA is…

A: Dna replicates semiconservatively is proven by matthew meselson and franklin stahl by performing an…

Q: DNA replication AND repair both finish with the action of Primase DNA polymerase l DNA polymerase II…

A: Primase- Primase is an enzyme that produces primers, which are short RNA sequences. Primase works by…

Q: ndicate whether each of the following statements are true of depurination, deamination or pyrimidine…

A: DNA is a long polymer of nucleotide. A nucleotide is made ip of sugar, nitrogenous bases, and…

Q: Replication of a circular DNA molecule can occur by either theta replication or by rolling circle…

A: DNA replication is a process that occurs in all living organisms. In this process, DNA strands of…

Q: Suggest a reason why it would be unlikely for replication to take place without unwinding the DNA…

A: Nucleic acids are the major class of biomolecules that are important for all forms of the organism.…

Q: What do you mean semi conservative nature of DNA replication. Who proved it & how?

A: DNA replication is a biological process in which two identical copies of the DNA produced from one…

Q: The important excision mechanism that repair DNA damage induced by UV light are called Base excision…

A: The above given statement is false . It is not known as base excision repair . The statement given…

Q: True or False: Polymerases open the DNA and create the replication bubble while helicases run…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around one…

Q: DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl…

A: DNA polymerase is an enzyme involved in the synthesis of DNA molecules by joining the dNTPs…

Q: One characteristic of the DNA molecule is its replication capability. What are the consequences of…

A: Deoxyribonucleic acid (DNA) encodes genetic information required for the proper functioning of…

Q: Enzyme function is critically important for the proper replication of DNA. Predict the consequence…

A: Enzymes are biological catalysts that enhance the speed of a reaction. This is performed by lowering…

Q: Optimal DNA replication requires the coordinated effort of all the following EXCEPT: A single strand…

A: Single stranded binding proteins prevent single stranded DNA from exonuclease activity during…

Q: slation The following is the base sequence of an exon portion of a template strand of a DNA…

A: In this question we are provided with information regarding DNA template strand and we have to find…

Q: Justify why the absorption of UV light by double-stranded DNA rises when the DNA is denatured (the…

A: Hyperchromicity is the result of a molecule's increased absorbance.

Q: will synthesize the in short pieces that are linked together by the enzyme , but the is made…

A: Deoxyribose nucleic acid (DNA) is the genetic material for almost all living organisms. DNA is a…

Q: Central Dogma Application: Using the basic concept of Process of central dogma provide the following…

A: According to the central dogma, the most common pattern of information in our cells is: From…

Q: . DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl…

A: The process of DNA synthesis occurs in all of the living organisms and serves as a base for…

Q: The most important features of DNA (deoxyribonucleic acid) replication.

A: Introduction The biological process of making two identical duplicates of DNA from a single original…

Q: The Escherichia coli chromosome is a circular DNA molecule and contains a single origin of…

A: Introduction : DNA replication in E.coli is a process through which daughter DNA synthesized from…

Q: DNA pol 3's inability to begin the replication process is solved by which enzyme? helicase primase…

A: DNA is genetic material in most of organisms . It act as template for synthesis of its own . This…

Q: The discontinuous aspect of replication of DNA in vivo is caused by trinucleotide repeats lack of…

A: Replication of DNA in vivo is described as semi discontinuous. This is because DNA replication takes…

Q: There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA…

A: The cellular functions are regulated/controlled by the DNA present within the nucleus of the cell.…

Q: Single-stranded regions of DNA are attacked by nucleasesin the cell, yet portions of DNA are in a…

A: DNA replication is the process of synthesizing new strands of DNA from the original double-helical…

Q: During DNA replication, 3 different proteins are used in the process to unwind and seperate the DNA.…

A: The process of making copies of the DNA during cell division is called DNA replication. The genetic…

Q: Which of the following DNA double helices would be more difficultto separate into single-stranded…

A: DNA/ RNA is made up of bases purines and pyrimidines apart from phosphate and sugar. Chargaff's rule…

Q: (a) Eukaryotic DNA replication is more complex than prokaryotic replication. Give one reason why…

A: a. Eukaryotic DNA replication is more complicated than prokaryotic replication because of the…

Q: Just prior to DNA replication the cytosine in the sequence GTTCATTG is deaminated and it is not…

A: The deamination means removal of the amino group (-NH2) from a particular molecule. In the cell…

Q: The semi discontinuity in DNA replication. Is it biologically possible for DNA to undergo…

A: Polymerase chain reaction (PCR) is in-vitro DNA synthesis technique. In PCR replication is not…

Q: Which repair process(es) use(s) a DNA polymerase? Select all that apply. base excision repair…

A: DNA polymerases are the enzyme required for the synthesis and replication of DNA. There are…

Q: Single-stranded regions of DNA are attacked by nucleases in the cell, yet portions of DNA are in a…

A: DNA replication is the process of production of identical copies of the DNA sequences. It is…

Q: Why does DNA polymerase require a primase in order to begin DNA replication? O DNA replication…

A: DNA polymerase (DNAP) is defined as the type of enzyme responsible for making new copies of DNA.…

Q: DNA polymerase III has Options O 5 to 3' polymerase activity O 3'-5' exonuclease activity OBoth A…

A: The polymerase enzyme helps in building lengthy polymer or nucleic acid chains.

Q: Tell Me Why - Why don't scientists who work with recombinant DNA know all the long-term effects of…

A: Recombinant DNA technology is a significant scientific advancement that has made human life…

Q: How does DNA replicate itself? Your explanation (in essay form) should include the following terms:…

A: DNA replication is a complex process where DNA makes copies of itself using a set of proteins,…

Q: DNA polymerase l moves toward the direction of replication fork creating Okazaki Fragments. * True…

A: Most living organisms that are well defined in terms of that they have DNA as their genetic…

Q: There are 6 parts to this question: This is a follow up to the prior question regarding the…

A: C. DNA Helicase- The enzyme responsible for separating the two strands of DNA in a helix so that…

Q: Which of the following is NOT a function of DNA polymerase I in E. coli? Question 1 options: A) 5'…

A: Answer: C) Helicase

Q: What are the advantages of the DNA utilizing thymine in respect of a low error during replication of…

A: DNA replication is the process of making DNA from a DNA strand. It involves many enzymes and stages.…

Question

I need explanation for the why the answer is correct? And why would the other options wrong

Which of the following is true of DNA repair?
a) DNA repair can only repair single nucleotide
changes in the DNA sequence.
b)DNA repair can be error-free or error-prone.
c)DNA repair always relies on the sister
chromatid as a template to repair DNA.
d)DNA repair always results in accurate repair of
changes in the DNA sequence.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Define the following words: replication fork, leading strand, lagging strand, Okazaki fragments, helicase, single strand, binding protein, primase, DNA polymerase 3, DNA polymerase 1, dna ligase and nuclease
List six types of DNA repair. Explain the basic features of each.
What is the purpose and benefit of the polymerase chain reaction?
How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.
Why is DNA replication called semiconservative?
If the sequence of one single strand of DNA is C-A-A-G-T-A-G-G-C-T, what is the sequence of the complementary strand? Describe the origin of each strand of the new double helices created after DNA replication. Why is DNA replication important to the growth and development of a multicellular organism? Place the following terms in the correct order from smallest to largest: Nucleosome, supercoils, coils, chromosome, DNA double helix
What accounts for the amazingly accurate replication of DNA, which keeps the mutation rate low?
Why is the replication of DNA referred to as a semiconservative process? What is the experimental evidence for the semiconservative nature of the process? What experimental results would you expect if replication of DNA were a conservative process?
What are some of the ways that organisms use to ensure the fidelity of DNA replication? Why is it important that the fidelity of DNA replication is an evolutionary balance between faithful replication and the existence of some errors? Escherichia coli and other bacteria methylate adenines on the original strand to distinguish the original strand from the newly replicated strand of DNA. Why is this distinction important?
Does E. coli chromosomal replication always start at one particular site? What is called? If you were given the DNA sequence of E. coli chromosome, would you be able to identify where E. coli chromosomal replication starts? What is the end of E. coli chromosome replication?
If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding daughter strand sequence? A. 3' - GGG - TAT - CTC - TTT - 5' B. 5' - GGG - TAT - CTC - TTT - 3' C. 3' - GGG - UAU - CUC - UUU - 5' D. 5' - GGG - UAU - CUC - UUU - 3'
Which of the following types of DNA damage would be hardest to repair using the DNA repair pathways?A. Complete removal of three nucleotides in the middle of one strand.B. A covalent bond between a base on one strand and a base on the complementary strand.C. Incorporation of a sugar other than deoxyribose into one strand.D. Covalent attachment of a short polypeptide to a single base.E. A covalent bond between a base and a deoxyribose on the same strand. Please explain why it's B