Which of the following sequences in double-stranded DNA ismost likely to be recognized as a cutting site for a restrictionenzyme?(A) AAGGTTCC(B) GGCCCCGG(C) ACCATGGT(D) AAAATTTT

Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced…

A: Introduction  Genes contains specific nucleotide sequences which can be transcribed into the mRNA by…

Q: In the Meselson–Stahl experiment thatestablished the semiconservative nature of DNA replication,the…

A: Replication follows the semiconservative mode, which was proved by the experiment conducted by…

Q: The restriction enzyme Alu I cleaves at the sequence 5’-AGCT- 3' , and Not I cleaves at 5'…

A: Restriction enzymes or restriction endonucleases are endonuclease enzymes capable of recognizing a…

Q: Remember when looking up a codon make sure it is in its mRNA form.   Below is a sample of a…

A: The spontaneous changes in the DNA that changes the original base sequence is called mutation. For…

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: hat is EcoRI? How does EcoRI differ from an exonuclease?

A: Restriction enzyme, also known as restriction endonuclease, is a bacterial protein that cleaves DNA…

Q: What is the consensus sequence of the following six DNA…

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…

A: According to Bartleby guidelines,  we are supposed to answer first three subparts in case of…

Q: Using the DNA strand shown here as a template, what will be the sequence of the RNA transcript? 5'…

A: A template is the strand that attach to the complementary strand via DNA polymerase and RNA…

Q: how are the polypeptide chains of protiens that are specified by dna assembled

A: Polypeptide chains undergo four levels of folding :  Primary structure: defined by their amino acid…

Q: Examination of the structure of DNA polymerases bound to nucleotide analogs reveals that conserved…

A: DNA polymerase is a member of a family of enzymes that catalyse the synthesis of DNA molecules from…

Q: Choose the combination of answers that most accurately completes the statement.Which of the…

A: Restriction endonuclease or restriction enzyme is a type of enzyme used in cloning studies. It is…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: If the DNA template strand was TACCTAGAT, what would the mRNA codons be?

A: This process is called transcription i.e synthesis of m RNA from DNA. The DNA strand that forms m…

Q: If a restriction enzyme cuts between the G and the A whenever itencounters the sequence GAATTC, how…

A: Answer is c.) four.

Q: Within the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC.…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…

A: Gene probes are small, single-stranded DNA or RNA that hybridize with the target DNA sequences in a…

Q: Segment of DNA SGCTAACCTGATCGCCGGTATT 3'CGATTGGACTAGCGGCCATAAS 3' 1. Transcribe and translate the…

A: The change in nucleotide is called a mutation. it could be a point mutation when one nucleotide is…

Q: A segment of one strand of a double-strandedDNA molecule has the sequence 5�-ACTTTCAGCGAT-3�. Whatis…

A: Transcription is the process of making an RNA copy of a gene sequence. As the nucleotide sequence of…

Q: You have discovered an enzyme secreted by a particularly virulent bacterium that cleaves the C2′—C3′…

A: Introduction: DNA, also known as deoxyribose nucleic acid is made up of nucleotides which comprises…

Q: Process by which the DNA sequences encoding exons are exchanged and reordered through genetic…

A: Exon :- the coding part of the gene. Intron :- the non coding regions of pre mature mRNa.

Q: You have determined that the newly synthesized strand of DNA in your sequencing reaction has the…

A: Template Strand will be: 3' TGATGGCTCA5'

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Why do DNA chips often contain segments derived from cDNA rather than genomic DNA segments?

A: DNA chip used in microarray

Q: Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting…

A: The process of cutting or cleaving DNA by using restriction enzymes is called digestion or…

Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five…

A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5…

Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If…

A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…

Q: The following sequence of nucleotides is found in a single-stranded DNA template:…

A: Transcription is a process through which the template strand of DNA transcribes into mRNA to carry…

Q: A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is…

A: DNA is the genetic material of the cell which gets transcribed into mRNA with the help of RNA…

Q: Consider the following sequence of DNA: 3'-TTA CGG-5' What dipeptide is formed from this DNA after…

A: The genetic information is present in the sequences of the DNA. The sequence of DNA that runs in the…

Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What MRNA would be produced…

A: The transcription process enables an enzyme known as RNA polymerase to bind to the DNA and break…

Q: In E. coli, a variety of mutator strains have been identified inwhich the spontaneous rate of…

A: Mutations are the alterations or the changes that occur in the DNA. Mutations are variations in…

Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…

A: DNA probes are single-stranded DNA segments that are hybridised to indicate the existence of…

Q: Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA…

A: They enhance the rate of a reaction without being consumed or modified during the reaction.…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: How many times would telomerase have to bind to a different site in the telomere to make a segment…

A: During the time of DNA copying, one of the strands is synthesizing continuously at the replication…

Q: Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA,…

A: DNA is the genetic material of almost all living organisms. The DNA is inherited from the parents…

Q: he enzymes BamH I and Bal II recognise different sequences but leave the same sticky ends:     BamH…

A: An enzyme that recognizes a specific sequence on the DNA strand and cuts the DNA into fragments is…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: Consider the following DNA template:   5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’…

A: Of the two strands of DNA, the template strand or non-coding strand is used for transcribing an mRNA…

Q: What enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the…

A: The bacterial chromosome is usually circular in shape: hence it can be completely replicated by the…

Q: Using the figure below identify: What is a function of introns and exons? What is a role of mobile…

A: DNA is packed up compactly in the nucleus of a cell in close association with histone proteins…

Q: A biochemist was able to sequence a DNA found in a human sample from humans who were first believed…

A: The DNA is a self-replicating structure formed of two strands. The DNA is formed of nucleotides. The…

Q: The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1:…

A: DNA is a hereditary molecule found in cells that transmits genetic information from one generation…

Q: Indicate the size in kilobases (kb) of DNA fragment(s) that you would expect to see if you cut a…

A: The plasmids are the extrachromosomal DNA in prokaryotic organisms. It is also found in some…

Q: What is the velocity of movement (in micrometers per second) of DNA polymerase III holoenzyme…

A: Axial distance between  nucleotides in B- DNA is 3.4 R catalytic rate of DNA polymerase 111 is 1000…

Q: How often, on average, would you expect a restriction endonuclease to cut a DNA molecule if the…

A: Restriction endonucleases are enzymes that function like molecular scissors. They cut the…

Proteins

We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.  

Protein Expression

The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.