Which of the following statements is true about transcription & translation? O a Ineukaryotes, pre-MRNA is synthesized directly from DNA which travels immediately to the cytoplasm to be translated into protein Ob. In prokaryotes, the transcription and translation are coupled, whlle In eukaryotes, both processes happen in the same site but at different time Oc In prokaryotes, transcription stops right at the terminator sequence, while in eukaryotes, RNA polymerase II transcribes additional nucleotide sequence O d. In prokaryotes, MRNA issynthesized directly from DNA by RNA polymerase II Oe Ineukaryotes, RNA polymerase Il can recognize and bind directly to the promoter region

Which of the following statements is true about transcription & translation? O a Ineukaryotes, pre-MRNA is synthesized directly from DNA which travels immediately to the cytoplasm to be translated into protein Ob. In prokaryotes, the transcription and translation are coupled, whlle In eukaryotes, both processes happen in the same site but at different time Oc In prokaryotes, transcription stops right at the terminator sequence, while in eukaryotes, RNA polymerase II transcribes additional nucleotide sequence O d. In prokaryotes, MRNA issynthesized directly from DNA by RNA polymerase II Oe Ineukaryotes, RNA polymerase Il can recognize and bind directly to the promoter region

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
Transcription and translation are separate processes in gene expression; however, they have similarities. The following terms all relate to translation. Which of these has a role that is most similar to that of the transcription start site during transcription? A)Start codon B)Stop codon C)tRNA D)Amino acid
Below is a template strand of DNA. Assume the transcription start site is outside of this sequence so that the whole sequence is transcribed. After the mRNA is made, what amino acid sequence would be translated from this sequence? Translation begins at the first start codon of the mRNA. DNA template strand: 5’ ...ACTGATGCCCATGGC... 3’ a)Met-Pro-Met b)Ala-Met-Gly-Ile-Ser c)Thr-Asp-Ala-His-Gly d)Met-Gly-Ile-Ser
I've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ Q.Where, approximately, will the transcription start site be?
In prokaryotes, transcription and translation occursimultaneously. In eukaryotes, the nuclear membranerestricts transcription to the nucleus; mRNAs aretranslated only after transport into the _______?.
Which of the following statements are true about eukaryotic mRNA?a. The sigma factor is essential for the correct initiationof transcription.b. Processing of the nascent mRNA may begin beforeits transcription is complete.c. Processing takes place in the cytoplasm.d. Termination is accomplished by the use of a hairpinloop or the use of the rho factor.e. Many RNAs can be transcribed simultaneously fromone DNA template
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. this statement true or false.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Which of the following statements about gene expression is false?a) More than one RNA polymerase can be transcribing a specific gene at a given time.b) More than one ribosome can be translating a specific transcript at a given time.c) Translation begins at a site called a promoter.d) Transcription stops at a site called a terminator.e) Some amino acids are coded for by more than one codon.
A particular DNA coding segment is ACGTTAGCCCCAGCT • Write the sequence of nucleotides in the corresponding mRNA. • Determine the amino acid sequence formed from the mRNA during translation. • What amino acid sequence results from each of the following mutations? a. replacement of the underlined guanine by adenine b. insertion of thymine immediately after the underlined guanine c. deletion of the underlined guanine