Which of the following statements is true about transcription & translation? O a. In prokaryotes, transcription stops right at the terminator sequence, while in eukaryotes, RNA polymerase II transcribes additional nucleotide sequence O b. In prokaryotes, mRNA is synthesized directly from DNA by RNA polymerase II Oc. In eukaryotes, RNA polymerase Il can recognize and bind directly to the promoter region O d. In eukaryotes, pre-mRNA is synthesized directly from DNA which travels immediately to the cytoplasm to be translated into protein

Which of the following statements is true about transcription & translation? O a. In prokaryotes, transcription stops right at the terminator sequence, while in eukaryotes, RNA polymerase II transcribes additional nucleotide sequence O b. In prokaryotes, mRNA is synthesized directly from DNA by RNA polymerase II Oc. In eukaryotes, RNA polymerase Il can recognize and bind directly to the promoter region O d. In eukaryotes, pre-mRNA is synthesized directly from DNA which travels immediately to the cytoplasm to be translated into protein

Name: 18 Which of the following statements is true about transcription & tra
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 18 Which of the following statements is true about transcription & translation?O a. In prokaryotes, transcription stops right at the terminator sequence, while in eukaryotes, RNA polymerase IItranscribes additional nucleotide sequenceO b. In prokaryo

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

The Events in Transcription Initiation Describe the sequence of events involved in the initiation of transcription by E. coil RNA polymerase. Include in your description those features a gene must have for proper recognition and transcription by RNA poIymerase.
Consider a mutation in -10 BOX promoter consensus sequence (TATAAT) in the prokaryote recA gene where the first T base mutated to G, what outcome(s) are likely? a. transcription levels will increase as the GC content would increase b. this mutation is silent, so no change in transcription level c. transcription levels would decrease because the promoter would be weaker d. transcription levels do not depend on the promoter sequence for the gal gene e. nothing would happen because the promoter would not change the mRNA sequence
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?
Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and2 are 546 bp and 466 bp respectively.a. Draw this gene showing the promoter, exons, introns and transcription initiationsites.b. This gene is found to encode two mRNAs. One of these mRNAs is 224 bp in shorter thanthe other.i. What is the biological process giving rise to this phenomenon called?What are the sizes of the two mRNAs (in bp) produced from this gene?
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ Q.Where, approximately, will the transcription start site be?
Which of the following statements are true about eukaryotic mRNA?a. The sigma factor is essential for the correct initiationof transcription.b. Processing of the nascent mRNA may begin beforeits transcription is complete.c. Processing takes place in the cytoplasm.d. Termination is accomplished by the use of a hairpinloop or the use of the rho factor.e. Many RNAs can be transcribed simultaneously fromone DNA template
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.
What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.
I've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?
A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of eIF-2 alter translation? a. Initiation factors would not be able to bind to mRNA. b. The large ribosomal subunit would not be able to interact with mRNA transcripts. c. tRNAi-Met would not scan mRNA transcripts for the start codon. d. eIF-2 would not be able to interact with the small ribosomal subunit.