Question
Which of the following two molecules of DNA has the lower melting
temperature? Why?
AGTTACTAAAGCAATACATC
TCAATGATTTCGTTATGTAG
AGGCGGGTAGGCACCCTTA
TCCGCCCATCCGTGGGAAT
View transcribed image text
Expand

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Molecular Biology

Related Biology Q&A

Find answers to questions asked by students like you.

Q: What is apiculture? What are the requirements to consider for bee–keeping?

A: Man and animals have always been living in harmony and man has been using animals for various purpos...

Q: Is duplication a mutation?

A: Mutation means sudden changes occur in DNA sequences. The mutation occurs randomly. It also occurs d...

Q: The idea that sperm carry more mutations thanoocytes makes sense. Explain how?

A: Mutation is defined as the sudden inheritable change that occurs in the DNA sequence.  It is caused ...

Q: What is average number of thrombocytes in blood? What is their function?

A: Thrombocytes or platelets are a part of blood, making it an insoluble component within the blood str...

Q: Using at least two examples, explain how the process of evolution is revealed by the imperfections o...

A: In biology, evolution is defined as the change in the characteristics of a species over many generat...

Q: Discuss the factors responsible for ascent of xylem sap in plants.

A: The ascent of sap is defined as the upward movement of water from root to aerial part of the plant. ...

Q: Write a note on cell theory

A: Botanist Matthias Scleiden and zoologist Theodor Schwann proposed Unified cell theory. Cell theory i...

Q: Mammals are most successfulland dominant animals todaygive evidence?

A: Class Mammalia includes mammals, bearing characteristic mammary glands. Their body is distinct into ...

Q: Which of the following terms is the most broad?   a phenotype b characte...

A: Genetics is a branch of biology which deals with the study of genes, genetic variation, and heredity...

Q: In tomatoes, tall (D) is dominant over dwarf (d) and smooth fruit (P) is dominant over pubescent fru...

A: The law of segregation proposes that the alternative forms of the genes that are known as alleles se...

Q: Antibiotic resistance genes are often found on R plasmids (see Natural Gene Transfer and Antibiotic ...

A: Antibiotic resistance is a phenomenon where the microorganisms bacteria develop resistance towards a...

Q: why there is Diminished fertility in translocation heterozygotes

A: Translocation heterozygotes generally carry cells with one normal set of chromosomes and one set in ...

Q: An integrated poultry production campany has acquired your services as an expert in Environmental mi...

A: Water is an essential element of our life. It maintains our body temperature, distributes other mine...

Q: Medications associated with worsening renal function

A: Chronic kidney disease, like in chronic glomerulonephritis, can result in the loss of red blood cell...

Q: For each of the following types of transcriptional control, indicate whether the protein produced by...

A: An inducible operon is one which is not transcribed. For transcription of the molecule, It requires ...

Q: What is the function of chromosome 22?

A: Chromosomes are the DNA containing structure that is inherited by the offsprings. Prokaryotic chromo...

Q: What causes Robertsonian translocation?

A: erved gene order and therefore the option is incorrect.  64.) Translocation is transfer of a part of...

Q: Management of contrast induced acute renal failure

A: Contrast-induced renal failure that is also known as contrast-induced nephropathy is a complication ...

Q: Some insecticides that act by preventing molting also can harm crustaceans accidentally exposed to t...

A: The members of phylum arthropoda are bilaterally symmetrical, invertebrate. They have an open circul...

Q: What do you mean by tentacle?

A: The majority of invertebrates and a small number of vertebrates possess tentacles. The invertebrates...

Q: (a) Distinguish between asexual and sexual reproduction. Why isvegetativereproduction also considere...

A: Organisms are capable of creating a new organism and pass on their genetic information by performing...

Q: What are similarities of sexual and asexual reproduction?

A: Sexual, as well as asexual reproduction, differ due to the process of gamete fusion in the former in...

Q: What is the nature of image formed on the retina of the eye?

A: The human eye is a sense organ. It reacts to light and allows vision. The cone and rod cells in the ...

Q: by what age a person with trisomy 13 can survive?

A: Trisomy 13 or Patau syndrome occurs when 3 copies of the chromosome-13 are present in each cell of t...

Q: What are gene deserts?

A: Genes carry coded genetic information in the form of specific nucleotide sequences. This specific nu...

Q: What is a balanced chromosomal rearrangement?

A: Chromosomes carry the genetic material DNA. Chromosomes may undergo rearrangements that are the muta...

Q: What are the main human diseases caused by roundworms?

A: Roundworms are type of parasitic worm that hatched in the intestine and lives there. The eggs of the...

Q: Correct the following statements :(a) Surgical methods of contraception prevent gamete formation.(b)...

A: Contraception is a method or process which used in controlling the birth. It will help to prevent he...

Q: With biological magnification, the highest pollution load will be in

A: Biological magnification: It refers to the process of increase in concentration of toxic substance a...

Q: Indicate which of the following provides an example of diffusion by answering yes or no. A sugar cub...

A: Diffusion is a process in which the movement of substance is from the area of the high concentration...

Q: Which structure completes cytokinesis in bacterial cells?   Question 39 options:   con...

A: Cytokinesis is the part of the cell division process during which the cytoplasm of a single eukaryot...

Q: Types of renal stones

A: Renal calculi are otherwise known as kidney stones. These stones appear as a solid mass.

Q: Describe DNA Mutations:    Definition: Define a mutation. Are they good or bad?    What types of mut...

A: A permanent modification in the DNA sequence that makes up a gene, such that the sequence differs fr...

Q: What are allergens? How do they cause inflammatory response inside human body?

A: Inflammation an immune response, which is triggered by the immune system in response to stimuli, suc...

Q: What is the role of protein kinases?   Question 1 options:   None of these   ...

A: Enzymes are the various biologically active proteins that catalyze various metabolic processes in th...

Q: What are chasmogamous flowers? Can cross-pollination occur in cleistogamous flowers? Give reasons fo...

A: Plants are mainly multicellular organisms, predominantly photosynthetic eukaryotes of the kingdom Pl...

Q: What are some similarities and differences between siRNAs and miRNAs?

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in decoding, co...

Q: The following pedigree shows what type of inheritance?

A: Pedigree analysis is the study of the hereditary patterns of the various generations of the family. ...

Q: How do amoebae, paramecia and trichomonas respectively move?

A: Protozoans are group of single-celled eukaryotes, either free-living or parasitic which feed on orga...

Q: Given a hierarchy of ecological systems, indicate what attributes will be of interest toyou at each ...

A: Ecology: The study of inter-relationship between an individual and its environment is termed as ecol...

Q: What are the names of the seven functional groups found in organic molecules? Underline the two that...

A: Organic molecules are the molecules with vast or large and complex chemical structures. These are pr...

Q: Fill in the blank:  The white matter of the spinal cord is divided into anterior, lateral, and poste...

A: White matter of the spinal cord is one of the two components of the central nervous system and is lo...

Q: What are Possible Dominance Relations in case of hypomorphic mutations?

A: Hypomorphic mutation: It is a type of mutation in which the alteration of gene produces a product wi...

Q: If you were doing sit-ups, which muscle group would you be working the most (if you were using corre...

A: Abdominal endurance plays an important role in the fitness and posture of the body. It is the abs ab...

Q: Given a hierarchy of ecological systems, indicate what attributes will be of interest toyou at each ...

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If y...

Q: IN which stage chromatin condenses into chromosomes?

A: Cell division is a procedure in which a parent cell divides into two daughter cells. The cell cycles...

Q: Does the SCN Control the Circadian Rhythm in Hamsters?

A: Suprachiasmatic nucleus or SCN is bilateral structure. It is the central pacemaker of the CTS (circa...

Q: What is protocooperation?

A: The branch of biology that deals with the relationship among various living organisms and with their...

Q: How do you describe Desertification

A: Desertification means degradation of land making it infertile and turns into a desert. This degradat...

Q: Which of the following sites would you predict to be present in the gene encoding a MRNA molecule an...

A: mRNA known as messenger RNA carries the genetic information that is copied from DNA. mRNA contains t...

Transcribed Image Text

Which of the following two molecules of DNA has the lower melting temperature? Why? AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG AGGCGGGTAGGCACCCTTA TCCGCCCATCCGTGGGAAT