Which of the following which of the following reactions is an endergonic reaction that could occur in a cell, but only if coupled to the hydrolysis of ATP? ( delta G= -32 kJ/ mol)?

Q: 1) What is the full name of the following molecule? 2) Briefly explain the functions of this…

A: The biochemistry of cells is greatly influenced by a variety of biological components. These…

Q: True statements regarding the TCA cycle EXCEPT     Its metabolic product is ATP.     It produces…

A: Citric acid cycle also known as kreb cycle or tricarboxylic acid cycle (TCA). This cycle occurs in…

Q: Does the presence of an uncompetitive inhibitor increase / decrease the apparent affinity of the…

A: Uncompetitive inhibition occurs when an inhibitor binds to an allosteric site of a enzyme, but only…

Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…

A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…

Q: 1.0 E oxygen saturation (Y) 0.6 0.4 0.2 0.0 20 40 60 blood pO₂ (torr) 80 100 120 for this picture…

A: Hemoglobin carries oxygen from the lungs to the tissues and CO2 from the tissues to the lungs. When…

Q: in the column chromatography of spinach extract Could you potentially see the usefulness of this…

A: INTRODUCTION : Column chromatography - It is a simple and the most popular separation and…

Q: Would you expect the structure of a competitive inhibitor of a given enzyme to be similar to that of…

A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…

Q: Acetyl-CoA is generated by E1 and E2 ... purpose of E3? (PDHC)

A: INTRODUCTION : Acetyl-CoA - It is a enzyme which is involved in many biochemical reactions of…

Q: In a hydrogen fuel cell, hydrogen gas and oxygen gas are combined to form water. Write the balanced…

A: Water molecule is a compound formed from hydrogen and oxygen gas. It has two Hydrogen atoms and one…

Q: impact on the number of electron carriers used by the electron transport chain? Select one: The…

A: Introduction Cellular respiration is of two types: aerobic respiration and anaerobic respiration.…

Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…

A: Enzymes are classified into six classes. They are oxidoreductases, transferases, hydrolases,…

Q: What is most correct about the following inhibition? Penicillin

A: The antibiotic penicillin irreversibly binds to and inhibits the activity of the transpeptidase…

Q: Glyceraldehyde-3-phosphate + NAD+ +  Pi   →    1,3-bisphosphoglycerate + NADH  +  H+ ∆G0’ =+6.3 kJ…

A: In a general reaction such as: aA + bB ⇌ cC + dD The free energy changes in chemical reactions are…

Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…

A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…

Q: Which technique would best seperate a protein that binds stongly to its substrate?

A: Chromatography is a technique that is used for separation of biological macromolecules form a…

Q: Which factor does NOT represent a barrier that prevents a reaction from taking place? substrate…

A: Reaction is a process by which a set of molecules is transformed to another. Many factors effect the…

Q: Ph.D Fernando, Harvard Professor of Genetic Epidemiology, knows a thing or two about Twins. He must…

A: S-adenosyl-methionine: It is a typical cosubstrate used in amino-propylation, transsulfuration,…

Q: The following scheme shows how acetylcholine esterase (AChE) enzyme hydrolyzes acetylcholine (ACh).…

A: A cholinergic enzyme called acetylcholinesterase (AChE) is mainly present in postsynaptic…

Q: Carbohydrates and proteins each generate 4kcal/g when oxidized in the bomb calorimeter but in…

A: Cellular respiration Cellular respiration is a collection of three metabolic pathways that generate…

Q: KINETIC CONSTANT No Na2HPO4 25mM Na2HPO4 50mM Na2HPO4 Vmax nmol p-NP. Min- 20.3252 14.30615 17.30104…

A: Active site is the site where a substrate molecule binds with an enzyme. The binding between a…

Q: H K Br Br H trans-2,3-dibromo-2-butene cis-1,2-dibromoethene Otrans-1,2-dibromoethene…

A: The structure given the question represents-  Answer- trans - 1,2- dibromoethene

Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…

A: AP sites are apuraniya sites that are created through the hydrolysis of N glycosyl bond between…

Q: The production of amino acids from proteins is an example of: a. a non-enzymatic reaction b.…

A: Proteins are large molecular weight polymers of amino acids with diverse biological functions.  Many…

Q: i) Re-arrange with the Michaelis Menten equation so it involves the ratio [S] Show all steps…

A: Michaelis-Menten equation A mathematical model called the Michaelis-Menten equation is used to…

Q: The Hb Yakima variation is caused by the mutation D99H, which results in a shift in oxygen binding…

A: Hemoglobin binds to oxygen and it appears in two state. The T state (tensed) and R state (relaxed).…

Q: 385 What acts as a reductant in the glutamate synthase reaction to catalyze the transfer of the…

A: Reductant is a substance that donates electrons to another substance and reduce it. In an…

Q: In a Myoglobin and azide ligand-receptor binding experiment, instead of using 3.5 µM myoglobin you…

A: Myoglobin acts as oxygen reserve in the muscle cells. Myoglobin (Mb) has higher affinity towards…

Q: The following peptides were separated using ion-exchange chromatography based on the use of an anion…

A: Ion exchange chromatography separates fractions based on net charge. There are two types of ion…

Q: A positive biuret test would indicate the presence of what type of molecules in the filtrate

A: Biochemical tests are lab experiments conducted to determine the identity of an unknown analyte in a…

Q: b) Why might the compound shown below act as a transition state analog of phosphoglucose isomerase?…

A: Nitrogen containing transition state analogues are used to inhibit the isomerization reaction of…

Q: F.28.   How will phosphorylation of serine change the pKa of Arg, increase, decrease, or no change

A: Serine is a polar but uncharged residue. Arginine is a basic residue due to the presence of an amine…

Q: What is an example of RNA editing? Changing a valine codon to a stop codon Methylation of cytosine…

A: Nucleic acids like DNA and RNA can be edited in various ways. Editing is done for various reasons…

Q: Describe two different ways in which glucose oxidase is regulated. These mechanisms of regulation do…

A: Glucose oxidase: It is an oxidoreductase that catalyzes the conversion of glucose to hydrogen…

Q: Describe the biological functions of lipids. What factorscan affect the transition temperature (Tm)…

A: Lipid is a biomolecule which is soluble only in nonpolar solvents. They are hydrocarbons which…

Q: Analyze each item carefully and write your complete solution. Cysteine is an important amino acid…

A: Note: As per the honor code we are allowed to answer the first two questions. Kindly resubmit the…

Q: NH₂ Methyltransferases NH₂ OH OH S-Adenosylmethionine (SAM) Transamination B Phosphate transfer…

A: Methyl metabolism is well conserved across bacteria to humans. S-Adenosyl methionine (SAM) is…

Q: ● What are the three things we need to know in order to begin to understand the way an active site…

A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. The substrate binds…

Q: E mitochondria Question #: 25 While developing new inhibitors we came up with new compound, a…

A: Enzymes are high molecular weight protein that catalyse biochemical reactions. They contain a active…

Q: Which metabolic event is not in the mitochondria?     Oxidation of fatty acids     ETC…

A: Glycolysis is a the pathway in which glucose is broken down into two three-carbon compounds and…

Q: What is the pI, and how is it determined for amino acids that have nonionizable R groups?

A: There are twenty amino acids which are categorized as basic, acidic, aromatic, aliphatic, or sulfur-…

Q: Which coenzyme is NOT paired with its correct dietary precursor? thiamine → thiamine pyrophosphate…

A: Coenzymes are important in the metabolic pathways as they help enzymes in catalysing the reactions.…

Q: Relate the molecular properties to physicochemical properties of the following lauric acid stearic…

A: Lipids are chemically diverse group of biomolecules that have two common properties: they are…

Q: 384 Hemoglobin: Allostery and Evolution Q5.1 - 2,3-BPG is a negative allosteric regulator of…

A: Hemoglobin (Hb) is a protein that is found in red blood cells. A specific protein called haemoglobin…

Q: Place the following enzymes in the correct order of action RNA 5' triphosphatase RNA polymerase II…

A: The newly synthesised mRNA is called the primary transcript. Before the primary transcript can be…

Q: Kt of glucose for GLUT1=3 mM, GLUT2=17 mM, GLUT 3=1.3 mM, and GLUT11=0.3 mM. Sketch a graph with…

A: The equation that gives the rate of transport of molecule is similar to the rate equation of…

Q: In the corn snake Pantherophis guttatus, there are several different color variants, including…

A: Introns are non-coding sequences and exons are coding sequences in the gene. Splicing is the process…

Q: Which of the following proteins can BEST serve as a marker to detect the presence of the chloroplast…

A: The presence of biological or molecular markers provides information regarding their source.…

Q: ATP stock (50 µM): Make pre-dilutions with 20, 15, 10, 5, 2,5 and 1,25 µM ATP (1000 μL of each)…

A: Molarity is a way of representing the concentration of a solution. Molarity is the number of moles…

Q: Insulin deficiency (occurrence/factors) factors affecting insulin levels including biological,…

A: The hormone insulin is in charge of permitting blood glucose to enter cells, giving them the energy…

Q: Which of the following statements is FALSE regarding oxidative phosphorylation? The pH is higher in…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…