Question
Y are considered simple, single-celled organisms and are believed to be the first cells.
okaryotes
eukaryotes
plant cels
amal cells
Expand
Transcribed Image Text

Y are considered simple, single-celled organisms and are believed to be the first cells. okaryotes eukaryotes plant cels amal cells

Expert Answer

1 Rating

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Cell Biology

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Which of the following are stages of translation? Select all that apply.   a.As the ribosome mo...

A: The translation is the process of converting the information in mRNA to Proteins. Ribosome which has...

Q: Discuss why heritability is an important phenomenon in agriculture.

A: The term heritability refers to the amount of phenotypic variation within a group of individuals tha...

Q: In the mitosis experiment, in what stage were most of the onion root tip cells in? Based on what you...

A: Introduction  Cytology refers to the study of cell such as cell morphology, physiology etc. As we kn...

Q: 2. Calculate the effective dilution. You were given a sample which contained 5.5mL of bacterial cult...

A: The method of making a more concentrated solution, more dilute by adding more solvent is called as d...

Q: Why is the orientation of muscle in the stomach wall important and how does it contribute to it’s fu...

A: The stomach walls contain three layers of smooth muscle arranged in longitudinal, circular, and obli...

Q: Contrast Generalized and Specialized Transduction. Include at least 4 major points of contrast.

A: Trusduction is the process of transfer of gene in prokaryotes from donar to recipient using bacterio...

Q: add 2.75 mL out of 5.0 mL of an undiluted sample to 125.25 mL. ad, you add all 5.0 mL to the 125.25 ...

A: We should we the formula to solve this question: Dilution factor = Final volume of the solution/Volu...

Q: "óu tell me briefly what caused the "bubbles" in the bread dough? We talked about it in the context ...

A:   It should be understood that Metabolism of sourdough microbiota and the activity of cereal enzymes...

Q: . Why was it necessary to make sure that chemicals could not movethrough the soil from one plant to ...

A: Researchers perform an experiment on pea plants to know whether drought-stressed plants communicate ...

Q: This is a plant cell, it’s pollen has 10 chromosomes, how many chromosomes would a cell in its leaf ...

A: Chromosomes are the thread-like structures located inside the nucleus of animal and plant cells. Eac...

Q: Which of the following codons is called the start codon? a.UAA   b.UGA   c.UAG ...

A: The connection between the series of nucleotide on mRNA and series of amino acid in the polypeptide ...

Q: Judy’s doctor tells her she’s got to lose some weight-at least 20 pounds, he says, to get her blood ...

A: Appetite and hunger both are related to the human need for food, The physical hunger is a physiologi...

Q: How does distribution of the gray crescent affectthe developmental potential of the first two daught...

A: Introduction: Gray crescent is a cortical region present in the egg of the frog that is recently fer...

Q: What's the answer these question

A: A neuron consists of body, Dendrites and Axon as the main part. The Dendrites are the receptive part...

Q: Why are prokaryotes so abundant and have such high diversity?

A: The reasons behind Prokaryotic abundance are listed below. Prokaryotes have been living on Earth fo...

Q: What is the map unit distance between the two genes? She obtains the following flies from this testc...

A: Gene mapping describe methods that are used for the identification of locus of the gene as well as d...

Q: 16. Which nitrogenous base is only found in RNA: a) adenine b) guanine c) thymine d) uracil

A: Nitrogenous base:- A molecule with the properties of a base and carries nitrogen is called nitrogeno...

Q: Match the expected result (purple, red, or colorless) to the following descriptions of Gram-stained ...

A: Introduction  There are various methods available for the classification of microorganisms such as B...

Q: 17. All nucleotides have the same organization, a phosphate group attached to a pentose (a 5 C sugar...

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each othe...

Q: Within a biofilm: cells are randomly distributed. cells are protected from easy penetration of large...

A: Biofilms are a collective of one or more types of microorganisms that can grow on many different sur...

Q: Two different strains of Drosophila melanogaster are mated in reciprocal crosses. When strain A male...

A: The reciprocal cross is defined as a cross which is used to test the role of parental sex on the giv...

Q: Why is the emergency department physician concerned about possible liver damage? How does liver dama...

A: The physician of the emergency department is concerned regarding any possible liver damage because l...

Q: Weigh the pros and cons of sanitizing food with more thorough methods vs less intense methods. Use e...

A: Sanitizing food is in great demand in today's scenario due to COVID-19 pandemic. There are many ways...

Q: DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ -Write the sequence of the RNA molecule that will be transcribed...

A: The transcription is the process in which the mRNA copied information from DNA for protein synthesis...

Q: Eukaryotic cells might have evolved from early prokaryotic cells living in close association. What d...

A: The endosymbiotic theory supports that the organelles that are present in the modern eukaryotic cell...

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC   1. Identify the gene from which the querysequence origina...

A: Hello. Since your question has multiple parts, we will solve first question for you. If you want rem...