A researcher was asked if his work on human telomere replication was related to any genetic disorders. He replied that one might think that any such mutations would be lethal during early development, but in fact a rare human genetic disorder affecting telomeres is known. This disorder, dyskeratosiscongenita (DKC), is associated with mutations in the protein subunits of telomerase, the enzyme responsible for replicating the ends of eukaryotic chromosomes. Initial symptoms appear in tissues derived from rapidly dividing cells, including the skin, nails, and bone marrow, and first affect children between the ages of 5 and 15 years.
How could such individuals survive?
To review:
The survivability of people with Dyskeratosis congenita (DKC).
Introduction:
Dyskeratosis congenital (DKC) is a rare genetic X chromosome-linked disease. Initial symptoms of this disease show up between the age of 5 to 15 years. People with DKC has the mutation on telomerase gene thus has non-functional telomerase. This disease affects the tissues with rapidly growing cells like skin, nails, and bone marrow.
Explanation of Solution
The tail region of the eukaryotic chromosome is known as the telomere. This region does not contain any functional genes but only guanine and a cytosine-rich tandem repeat of nucleotides. DNA (deoxyribonucleic acid) polymerase responsible for DNA replication cannot replicate the telomere region efficiently. Thus telomerase play a crucial role in replication of telomere. Here in case of persons withDyskeratosis congenita (DKC), after every successful cell division, a part of the telomere region gets lost in the newly divided cell. This problem is known as end replication problem.
The eukaryotic cells use telomerase to replicate telomere, which can successfully replicate the telomere region without losing any of its regions. The whole telomere region of the people with non-functional telomerase gets lost after a few early cell division. However, as this telomere region does not has any functional genes that could affect the cell functionality, early cell divisions can occur smoothly.
The patients can survive early development. Once the whole telomere region gets lost and functional genes present near the telomere region starts getting lost due to further cell division, only then, the patients show symptoms of DKC. That occursnormally between 5- 15 years of age.
Dyskeratosis congenita (DKC) appears among people who have mutated loss-in-function telomerase. Therefore, it can be concluded that the people with non-functional telomerase can survive early development. After that, they will start showing symptoms ofDKC, which includes nail dystrophy, abnormal skin pigmentation, and bone marrow failure.
Want to see more full solutions like this?
Chapter 10 Solutions
ESSENTIALS OF GENETICS MCC BUNDLE >BI<
- What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forwardIs it possible for their to be a mutation where an individual has incomplete or missing sets of chromosomes? or Would that simply result in the loss of life? I would say an easier way to describe a genome is by calling it either a blueprint of DNA or referring it as one full set of genetic information.arrow_forwardBased on what you have learned with respect to various DNA repair pathways, decide the most appropriate pathway that would be used to repair the following types of DNA damage. Explain your reasoning. A change in the DNA sequence caused by a mistake made by DNA polymerase during replication In a fungal species, pyrimidine dimers induced as a result of UV exposure A double-stranded break that occurs during G1 and prevents completion of DNA replicationarrow_forward
- Explain the connection between defects in DNA repair systemsand the inherited human disease xeroderma pigmentosum.arrow_forwardDuring DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer and the first incoming deoxyribonucleotide for an Okazaki fragment on the lagging strand? topoisomerase DNA polymerase III DNA helicase DNA polymerase II DNA ligase Heterogeneous nuclear RNA is typically characterized by which of the following features? it is more common in prokaryotes than in eukaryotes it contains introns, but no exons it contains more exons than introns it contains exons, but no introns it contains more introns than exonsarrow_forwardA chromosome has the following segments, where • represents the centromere: A B • C D E F G What types of chromosome mutations are required to change this chromosome into each of the following chromosomes? (In some cases, more than one chromosome mutation may be required.) a. A B A B • C D E F G b. A B • C D E A B F G c. A B • C F E D G d. A • C D E F G e. A B • C D E f. A B • E D C F G g. C • B A D E F G h. A B • C F E D F E D G i. A B • C D E F C D F E Garrow_forward
- Define the following terms: a. A-DNA b. B-DNA c. pseudogene d. cruciform e. intronarrow_forwardBelow is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forwardWhich of the following is NOT an example of a spontaneous mutation? A) errors in replication of DNA polymerase B) ALL of these are examples of spontaneous mutations C) covalent alteration of DNA by chemical products of fatty acid metabolism D) incorporation of a nucleotide analog during DNA synthesis E) failure to correct an apurinic site F) nondisjunction during meiosisarrow_forward
- All of the following statements about telomerase are correct except: A. the RNA component acts as a template for the synthesis of a segment of DNA. B. it adds telomeric repeats to the 5'-ends of the DNA strands. C. it provides a mechanism for replicating the ends of linear chromosomes. D. it recognizes a G-rich single strand of DNA E. it is a reverse transcripcase.arrow_forwardHuman Fbh1 helicase is important in the process of DNA replication. When a mutation occurs during the production of Fbh1, the result is a mutant Fbh1 that binds at the replication fork and prevents any helicase protein from attaching to the strand. Based on this information and the image shown, what would happen during DNA replication if this mutant helicase were present? A - Topoisomerase would unwind the DNA and an RNA primer would attach to the DNA molecule and initiate replication. The process would then stop at the blue triangle because helicase is needed to separate the strands of DNA. B - Topoisomerase would unwind the DNA, but then the process would stop at the blue triangle because helicase, the RNA primer, would not be able to attach to the DNA molecule and initiate replication. C - The process would begin at the blue triangle when topoisomerase unwinds the DNA and an RNA primer attaches to the DNA molecule and initiates replication. DNA polymerase would begin the synthesis…arrow_forwardHow does the enzyme telomerase meet the challenge of replicating the ends of linear chromosomes? It adds a single 5' cap structure that resists degradation by nucleases. It adds numerous GC pairs, which resist hydrolysis and maintain chromosome integrity. It causes specific double-strand DNA breaks that result in blunt ends on both strands. It catalyzes the lengthening of telomeres, compensating for the shortening that could occur during replication without telomerase activity.arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning