Concept explainers
If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC
- a. Two
- b. Three
- c. Four
- d. Five
Introduction:
Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.
Answer to Problem 1MCQ
Correct answer:
There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.
Explanation of Solution
Reason for correct statement:
Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:
As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.
Option (c) is given as “Four”.
As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.
Hence, option (c) is correct.
Reasons for the incorrect statements:
Option (a), is given as “Two”.
The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.
Option (b), is given as “Three”.
The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.
Option (d), is given as “Five”.
For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.
Hence, options (a), (b), and (d), are incorrect.
Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.
Want to see more full solutions like this?
Chapter 11 Solutions
Combo: Loose Leaf Version of Biology: Concepts & Investigations packaged with Connect Access Card
Additional Science Textbook Solutions
Essentials of Genetics (9th Edition) - Standalone book
Microbiology: An Introduction
Essentials of Human Anatomy & Physiology (12th Edition)