Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 12, Problem 18P
Interpretation Introduction
Interpretation:
The affect of the replacement of tryptophan by cysteine to the
Concept introduction:
DNA stands for deoxyribonucleic acid, is a biological macromolecule. In organisms, it carries genetic information and is required for protein production, cell reproduction, regulation and metabolism.
There are four base types of DNA: adenine (A), cytosine (C), guanine (G) and thymine (T). The adenine is complementary nucleotide for thymine and cytosine is the complementary nucleotide for guanine.
Proteins are the biomolecules which are composed of the long chain of amino acid residues.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Preparing cDNA Libraries from Different Cells Describe an experimental protocol for the preparation of to cDNA libraries, one from anaerobically grown yeast cells and the second from aerobically grown yeast cell.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Sequence Relationship Between an Antisense RNA Strand and Its Template DNA Strand The DNA strand that is complementary to the template strand copied by RNA polymerase during transcription has a nucleotide sequence identical to that of the RNA being synthesized (except T residues are found in the DNA strand at sites where U residues occur in the RNA). An RNA transcribed from this nontem-plate DNA strand would be complementary to the mRNA synthesized by RNA polymerase. Such an RNA is called antisense RNA because its base sequence is complementary to the “sense mRNA. One strategy to thwart the deleterious effects of genes activated in disease slates (such as cancer) is to generate antisense RNAs in affected cells. These antisense RNAs would form double-stranded hybrids with mRNAs transcribed from the activated genes and prevent their translation into protein. Suppose transcription of a cancer-activated gene yielded an mRNA whose sequence included the segment 5’-UACGUCUAAGCUGA. What is the corresponding nucleotide sequence (5’ The template strand in a DNA duplex that might be introduced into these cells so that an untisense RNA could be transcribed from it?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Solving the Sequence of an Oligopeptide From Sequence Analysis Data Amino acid analysis of a decapeptide revealed the presence of the following products: The following facts were observed: Neither car boxy peptidase A nor B treatment of the- decapeptide had any effect. Trypsin treatment yielded two tetrapcptides and free Lys. Clostripain treatment yielded a tetrapcptide and a hexapeptidc. Cyanogen bromide treatment yielded an octapeptide and a dipeptide of sequence NP (using the one-letter codes). Chymotrypsin treatment yielded two tripeptides and a telrapeptide. The N-terminal chymotryptic peptide had a net charge of — 1 at neutral pi I and a net charge of —3 al pH 12. One cycle of Ed man degradation gave the PTH derivative What is the ammo acid sequence of this decapeptide?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. CRISPR/Cas9: Design of a gRNA to Target the Human PVALB Gene The human PVALB gene, which encodes the Ca2+-binding protein parvalbumin, can be Targeted by CRISPR/Cas9, at the protospacer sequence - ATGCAGGAGGGTGGCGAGAGGGGCCGAGAT- followed by a -TGG-PAM trinucleotide. Give the sequence of the spacer region of a gRNA that will target the complementary DNA strand at this site. Include at the 3'-end of your gRNA sequence a region that will form a stem-loop structure with a 5'-AGCAUAGCUGUAAAAC- sequence downstream in the gRNA to create the dsRNA-binding site for Cas9.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. An Estimation of Minimal Genome Size for a Living Cell Studies of existing cells to determine the minimum number of genes for a living cell have suggested that 206 genes are sufficient. If the ratio of protein-coding genes to non-protein-coding genes is the same in this minimal organism as the genes of Mycoplasma genitulium, how many proteins are represented in these 206 genes. How many base pairs would be required to form the genome of this minimal organism if the genes are the same size as M genilalium genes? (Section 1.5)arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Evaluation of -Helices in Proteins The hem agglutinin protein in influenza virus contains a remarkably long -helix, with 53 residues. How long is this -helix (in nm)? How many turns does this helix have? The typical residue in an -helix is involved in two H bonds. How many H bonds are present in this helix?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. (Research Problem) The Nature and Roles of Linear Motifs in Proteins In addition to domains and modules, there are other significant sequence patterns in proteins—known as linear motifs—that are associated with a particular function. Consult the biochemical literature to answer the following questions: 1. What are linear motifs? 2. How are they different from domains?. 3. What are their functions? 4. How can they be characterized? 5. There are several papers that are good starting points for this problem. Neduva, V., and Russell, R., 2005. Linear motifs: evolutionary interaction switches. FEBS Letters 579:3342-3345. Gibson, T., 2009. Cell regulation: determined to signal discrete cooperation. Trends in Biochemical Sciences 34:471-482. Diella, K. Haslam, N., Chica., C. et aL, 2009. Understanding eukaryotic linear motifs and their role in cell signaling and regulation. Frontiers of Bioscience 13:6580-6603.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. To fully appreciate the elements of secondary structure in proteins, it is useful to have a practical sense of their structures. On a piece of paper, draw a simple but large zigzag pattern to represent a -strand. Then fill in the structure, drawing the locations of the moms of the chain on this zigzag pattern. Then draw a simple, large coil on a piece of paper to represent an -helix. Then fill in the structure, drawing the backbone atoms in the correction locations along the coil and indicating the locations of the R groups in your drawing.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence (53)ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Deducing DNA Sequence from Sanger Sequencing Results The output of an automated DNA sequence determination by the Sanger dideoxy chain termination method, performed as illustrated in Figure 11.3, is disp1ayed at right. What is the sequence of the original oligonucleotide?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Calculating Tms and Separating DNA Molecules That Differ in G:C Content At 0.2 M Na+, the melting temperature of double-stranded DNA is given by the formula, Tm = 69.3 + 0 41 (% G + C). The DNAs from mice and rats have (G + C) contents of 44% and 40%, respectively. Calculate the Tms for these DNAs in 0.2 M NaCl. If samples of these DNAs were inadvertently mixed, how might they be separated from one another?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Relationship Between the Nucleotide Sequence of an mRNA and the DNA Strand from Which It Is Transcribed Messenger RNAs are synthesized by RNA polymerases That read along a DNA Template strand in The 3' 5' direction, polymerizing ribonucleotides in The 5' 3r direction (see Figure 10.20). Give the nucleotide sequence (5r 3') of the DNA template strand from which The following rnRNA segment was transcribed: 5'-LAGL GAC AGUUGCGAU-3'.arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY