HUMAN HEREDITY (LL)-W/MINDTAP ACCESS
11th Edition
ISBN: 9781305717022
Author: Cummings
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 13, Problem 8QP
Summary Introduction
To describe: The reasons behind the advantage that a number of restriction enzymes recognition sites read the same when reading from either side of the strand of DNA molecule.
Introduction: Every restriction enzyme is specific in forming the incisions in the strand of DNA by recognizing the specific sites in genome sequence. The DNA strands are formed from the clubbing of various nucleotides that are joined to each other by hydrogen bonding. Nucleotides are attached to each other by being complementary in origin.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Restriction endonuclease and ligase are two types
of enzymes used in the process of genetic
engineering, i.e., the manipulation of genes. The
restriction endonuclease differs from ligase in that it
breaks the DNA at ends, while ligase causes
the breaks in DNA from interior
joins the fragments of DNA, while ligase
breaks the DNA into fragments
breaks the DNA at specific points, while the
ligase joins the fragments of DNA
breaks the DNA apart at each nucleotide,
while ligase use the pieces to translate
Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?
Your cloning vector has restriction recognition sites for two restriction endonucleases, EcorI and BamHI. However, the DNA to be manipulated does not have recognition sites for these two restriction endonucleases. How would you construct a recombinant DNA for the given DNA?
Chapter 13 Solutions
HUMAN HEREDITY (LL)-W/MINDTAP ACCESS
Ch. 13.5 - Do you think the way this issue was handled should...Ch. 13.5 - Prob. 2EGCh. 13.7 - If you were offered the chance to have the genome...Ch. 13.7 - Prob. 2EGCh. 13 - Improving the nutritional value of food has long...Ch. 13 - Improving the nutritional value of food has long...Ch. 13 - Prob. 3CSCh. 13 - What Are Clones? Cloning is a general term used...Ch. 13 - Prob. 2QPCh. 13 - Prob. 3QP
Ch. 13 - Prob. 4QPCh. 13 - Prob. 5QPCh. 13 - Prob. 6QPCh. 13 - Cloning Genes Is a Multistep Process The following...Ch. 13 - Prob. 8QPCh. 13 - Prob. 9QPCh. 13 - Cloning Genes Is a Multistep Process Which enzyme...Ch. 13 - Cloning Genes Is a Multistep Process In cloning...Ch. 13 - Prob. 12QPCh. 13 - Prob. 13QPCh. 13 - Prob. 14QPCh. 13 - Prob. 15QPCh. 13 - Cloned Libraries You are running a PCR to generate...Ch. 13 - Prob. 17QPCh. 13 - Prob. 18QPCh. 13 - Prob. 19QPCh. 13 - Analyzing Cloned Sequences A base change (A to T)...Ch. 13 - Prob. 21QPCh. 13 - Analyzing Cloned Sequences What kind of...Ch. 13 - Prob. 23QP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- When performing cloning experiments, it is not always necessary to treat sources of DNA with the same restriction enzyme. For example, DNA treated with EcoRI can be combined with DNA from a treatment using FunII. Explain why this is possible.arrow_forwardThe figure below shows the recognition sequences and cleavage positions of three restriction enzymes.You plan to ligate DNA from two different sources. The target DNA is digested with BamHI,and the insert DNA is digested with BglII, and the resulting fragments mixed and incubatedwith DNA ligase. a) Write out the sequence (in double-stranded format) of the longest insert fragment that will result after BglII digestion, ensure the nature of the overhangs is clear.b) Write out the sequence (in double-stranded format) of the ligation product, with the insert fragment joined into the BamHI site of the target DNA. Use black for target sequences, and blue for insert sequences. c) Assume the ligation reaction was successful and you have generated a recombinant DNAmolecule. Which of the three enzymes listed above can be used to excise the insert DNAfrom the target? Motivate your answer.arrow_forwardExamine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACarrow_forward
- Refer to the succeeding diagram of two DNA samples (A, B) with the specific restriction enzyme (RE) recognition sites marked with arrows. A spontaneous mutation (insertion) occurred in DNA sample A and introduced an additional restriction site. RE site RE site RE site RE site ↓↓ ↓ A RE site RE site RE site ↓ B Design two (2) DNA probes to be used in RFLP analysis involving these two DNA samples. Draw/illustrate the region(s) in the DNA molecule which you will use as reference (homologous) sequences in the design of the probes, THAT - a. Will reveal RFLP polymorphism between the DNA samples after probe detection/visualization; and b. Will not reveal RFLP polymorphism between the DNA samples c. Illustrate and briefly explain the expected result from this RFLP marker analysis. (Assume that the DNA probe is labelled with 32P radioactive isotope).) [answer in maximum 5 sentences ONLY]arrow_forwardAfter restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present. In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G 3' -----CTTAA 5' GTGCA^C means that the end will be: -----GTGCA 3' -----C 5' Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC BamHI G^GATCC ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGAarrow_forwardA restriction map lists the locations of DNA sequences that are cut by a particular restriction enzyme for a piece of DNA, such as a chromosome or a plasmid. Restriction maps are important when generating a construct for experimental use. Digesting the DNA sequence with the restriction enzymes will result in fragmented DNA of predictable sizes, based on the restriction map, that allow a researcher to analyze if his or her construct was generated correctly when visualized using gel electrophoresis. Use the linear restriction map to predict where bands would be expected on a gel if a digest is performed using the specified restriction enzymes. Assume that there is enough restriction enzyme that every possible restriction site on each molecule of DNA will be cut.arrow_forward
- Please put in correct orderarrow_forwardYou want to clone a specific PCR amplicon. You have determined that the amplicon you want to clone has enzyme restriction sites for HindIII and EcoRI. After investigation you have seen that the pUC18/19 plasmid also have these enzyme restriction sites in its multiple cloning site (MCS on map included). After enzyme digestion your amplicon is 854 bp long. What length will the recombinant plasmid be after you have inserted your amplicon? Show a calculation.arrow_forwardWhat is a restriction enzyme? What structure does it recognize?What type of chemical bond does it cleave? Be as specific aspossible.arrow_forward
- Please help with this as soon as you can, thank you.arrow_forwardDescribe the process for shotgun sequencing of a genome. Practice aligning the two sets of sequenced fragments below, to determine the order of the fragments and the complete sequence.arrow_forwardWhich of the following is true about restriction endonucleases?a) Type I and II requires ATP to move along DNAb) Type I, II and III requires ATP to move along DNAc) Type II requires no ATP and cleaves DNA within recognition sequenced) Type II requires ATP and cleaves DNA within recognition sequencearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License