Biology
12th Edition
ISBN: 9780134813448
Author: Audesirk, Teresa, Gerald, Byers, Bruce E.
Publisher: Pearson,
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 13.3, Problem 1TC
Summary Introduction
To explain: The way in which translated peptide differs when the guanine molecules are substituted by uracil in the mRNA sequence.
Introduction: In the substitution mutations, a single
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Sequence the following steps in protein synthesis from first to last. Write only the numbers (1-6) on space provided for;
____a. transcription
____b. tRNA amino acid
____c. amino acids separate from tRNA
____d. polypeptide chain assembled
____e. mRNA links to ribosome
____f. stop codon encountered in mRNA
Match each term with the most appropriate description.
sites for polypeptide assembly
binds to ribosomes to begin translation
a tRNA triplet complementary to a mRNA codon
complex with proteins to form ribosomes
Part A) In your own words describe what happens in transcription and translation
Include which types of nucleic acids are involved in each step
Describe the function of each type of nucleic acid in the process of making proteins
Part B) Also, explain how two nucleic acids "recognize" or "talk" to each other
Chapter 13 Solutions
Biology
Ch. 13.1 - describe three types of RNA that play roles in...Ch. 13.1 - Prob. 2CYLCh. 13.1 - Prob. 3CYLCh. 13.2 - Prob. 1TCCh. 13.2 - Prob. 1CYLCh. 13.2 - Prob. 2CYLCh. 13.2 - describe an example of post-transcription...Ch. 13.3 - Prob. 1TCCh. 13.3 - Prob. 1CSCCh. 13.3 - Prob. 1CYL
Ch. 13.3 - Prob. 2CYLCh. 13.3 - Prob. 3CYLCh. 13.3 - Prob. 4CYLCh. 13.4 - Prob. 1CSCCh. 13.4 - describe three different types of mutations?Ch. 13.4 - Prob. 2CYLCh. 13.5 - Prob. 1HYEWCh. 13.5 - Envision yourself as a physician. A mother,...Ch. 13.5 - Prob. 2TCCh. 13.5 - Prob. 1CYLCh. 13.5 - Prob. 2CYLCh. 13.5 - Prob. 3CYLCh. 13.5 - Prob. 4CYLCh. 13.5 - Prob. 1CTCh. 13 - Prob. 1MCCh. 13 - Which of the following is not true of RNA? a. It...Ch. 13 - Prob. 3MCCh. 13 - Prob. 4MCCh. 13 - Prob. 5MCCh. 13 - Synthesis of RNA from the instructions in DNA is...Ch. 13 - Prob. 2FIBCh. 13 - Prob. 3FIBCh. 13 - Prob. 4FIBCh. 13 - Prob. 5FIBCh. 13 - If a nucleotide is replaced by a different...Ch. 13 - Prob. 1RQCh. 13 - Name the three types of RNA that are essential to...Ch. 13 - Prob. 3RQCh. 13 - Prob. 4RQCh. 13 - Prob. 5RQCh. 13 - Prob. 6RQCh. 13 - Prob. 7RQCh. 13 - Define mutation. Describe four different effects...Ch. 13 - Prob. 1ACCh. 13 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain Circular structure of mRNA increases translation efficiency with the help of diagram.arrow_forwardEvaluate the following statements. Which one statement is false? a. The active form of prokaryotic RNA polymerase is a haloenzyme. b. Anti-codons are a nucleotide triplet in transfer RNA that are complementary and antiparallel to the codons of messenger RNA c. During translation, the terminal carboxyl group of an existing peptide will form a peptide bond with the next amino acid in sequence. d. The amino acid R-group is necessary for the formation of tertiary and quaternary structures through covalent bonds, ionic bonds, hydrogen bonds, and hydrophobic interactions. e. The sigma factors of prokaryotes are responsible for binding a DNA promotor sequence so translation can begin. f. The terminal carboxyl and terminal amino groups of amino acids within a peptide are necessary for the formation of secondary structures through hydrogen bonds. g. A restriction enzyme can target supercoiled, relaxed, or linearized plasmid DNA. h.…arrow_forwardANSWER THESE QUESTION; Click Edit DNA and make a substitution mutation that changes the first base (C) in the second codon to an A. Ø What effect does this mutation have on the polypeptide? Compare to the original polypeptide. Ø What is the resulting polypeptide: Ø What effect might this have on the function of the protein? Why? arrow_forward
- Analyze the following amino acid sequence and write down a potential mRNA sequence from which this sequence might have been translated. Use the codon table in your book to determine a possible mRNA sequence. Amino Acid Sequence 1: H3N+-Methionine-Valine-Histidine-Leucine-Threonine-Proline-Glutamic Acid-Glutamic Acid-COO-arrow_forwardPick either one of the following to answer: 1) Transcription and translation both involve an initiation, elongation, and termination phase. Describe how each of these phases occurs for both transcription and translation. OR 2) Both transcription and translation involve modifications following the termination step. Describe these modifications and the importance of each modification to complete the final product.arrow_forwardMatch the function in translation to each type of RNA (one RNA has two listed functions). 1) Carry an amino acid that is encoded by a codon. 2) Serve as the link between DNA and proteins. 3) Create the backbone of the ribosome 4) Has triplet-nucleotide codons that encode the primary structure of proteins. Here are the choices for the questions: a) tRNA b) rRNA c) mRNAarrow_forward
- Choose the answer that has these events of protein synthesis in the proper sequence. (Note some steps may be missing) A peptide bond forms A small ribosomal subunit binds with the mRNA. The tRNA leaves the P site, and the ribosome translocates to the P site. The Methionine initiator-tRNA binds to the start codon. An incoming amino-acyl tRNA binds to the A site The large ribosomal subunit binds the small subunit Group of answer choices A 4, 1, 2, 5, 6, 3 B 2, 4, 6, 5, 1, 3 C 1, 3, 2, 4, 5, 6 D 4, 1, 3, 2, 5, 6 E 5, 4, 3, 2, 6, 1arrow_forwardGive typing answer with explanation and conclusion Which of the triplets below is a possible anticodon for a tRNA that transports proline to a ribosome? Use your genetic code. Group of answer choices 3′-UUC-5′ 3′-CCG-5′ 3′-GGC-5′ 3′-CCC-5′arrow_forwardUse the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?arrow_forward
- Compare and contrast the process of protein synthesis in bacterial and eukaryotic cells, giving similarities and differences in the process of translation in these two types of cells.arrow_forwardDescribe the steps (Initiation, Elongation and Termination) involved in translation of mRNA to generate a protein, including the all the important molecules involved and how they interact. Diagrams MUST be included in your answer. (Draw on some paper, then photograph and insert the drawing below.) You may add to your answer using bullet points if you find it easier, but make sure they are in the correct order!arrow_forwardConsider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. 1. How many codons are represented in this oligonucleotide? 2. If the second G were changed to a C, what would be the resulting amino acidarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY