Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13.4, Problem 1COMQ
Summary Introduction
Introduction:
In translation, apart from the mRNA (messenger ribonucleic acid) transcript and the ribosome, tRNAs (transfer RNAs) have a major role. They read the codons in the transcript and bring anti-codons corresponding to them so as to attach them to the polypeptide chain that is being synthesized.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which statement is true of the translocation phase of elongation during protein synthesis?
a.
The empty tRNA moves to the A site of the ribosomal complex.
b.
The empty tRNA moves to the T site of the ribosomal complex.
c.
The dipeptide moves from the A site to the P site of the ribosomal complex.
d.
The dipeptide moves from the P site to the A site of the ribosomal complex.
Which statement BEST DESCRIBES the tRNA structure?
A. Amino acids bind to the 5′ end of the tRNA molecule.
B. When a tRNA has an amino acid attached to it, it is considered to be a charged tRNA
C. Synthetases are not important to tRNA
D. Amino acids are linked to tRNAs with hydrogen bonds
How are rare bases incorporated into tRNAs?
a. Encoded by guide RNAs
b. By chemical changes to one of the standard bases
c. Encoded by rare bases in DNA
d. Encoded by sequences in introns
Chapter 13 Solutions
Genetics: Analysis and Principles
Ch. 13.1 - Prob. 1COMQCh. 13.1 - 2. The reason why Beadle and Tatum observed four...Ch. 13.2 - What is the genetic code? a. The relationship...Ch. 13.2 - Prob. 2COMQCh. 13.2 - The fourth codon in an mRNA sequence is GGG, which...Ch. 13.2 - Prob. 4COMQCh. 13.3 - Prob. 2COMQCh. 13.4 - Prob. 1COMQCh. 13.4 - 2. The anticodon of a tRNA is located in the
a....Ch. 13.4 - An enzyme known as _______attaches an amino acid...
Ch. 13.5 - Each ribosomal subunit is composed of a. multiple...Ch. 13.5 - Prob. 2COMQCh. 13.6 - 1. During the initiation stage of translation in...Ch. 13.6 - The Kozak rules determine a. the choice of the...Ch. 13.6 - During the peptidyl transfer reaction, the...Ch. 13.6 - A release factor is referred to as a molecular...Ch. 13 - Prob. 1CONQCh. 13 - What does it mean when we say that the genetic...Ch. 13 - According to the adaptor hypothesis, is each of...Ch. 13 - Prob. 4CONQCh. 13 - Prob. 5CONQCh. 13 - 6. The wobble rules for tRNA-mRNA pairing are...Ch. 13 - Prob. 7CONQCh. 13 - Prob. 8CONQCh. 13 - Prob. 9CONQCh. 13 - If a tRNA has an anticodon sequence 3CCI5, what...Ch. 13 - Describe the anticodon of a single tRNA that could...Ch. 13 - Prob. 12CONQCh. 13 - Prob. 13CONQCh. 13 - 14. What is the role of aminoacyl-tRNA synthetase?...Ch. 13 - Prob. 15CONQCh. 13 - 16. Discuss the significance of modified bases...Ch. 13 - How and when does formylmethionine become attached...Ch. 13 - Prob. 18CONQCh. 13 - Prob. 19CONQCh. 13 - Prob. 20CONQCh. 13 - The term subunit can be used in a variety of ways....Ch. 13 - 22. Do the following events during bacterial...Ch. 13 - 23. What are the three stages of translation?...Ch. 13 - Prob. 24CONQCh. 13 - 25. For each of the following initiation factors,...Ch. 13 - Prob. 26CONQCh. 13 - 27. For each of the following sequences, rank them...Ch. 13 - Prob. 28CONQCh. 13 - Prob. 29CONQCh. 13 - Prob. 30CONQCh. 13 - Prob. 31CONQCh. 13 - In which of the ribosomal sites, the A site, P...Ch. 13 - Prob. 33CONQCh. 13 - Prob. 34CONQCh. 13 - Prob. 35CONQCh. 13 - Prob. 36CONQCh. 13 - Prob. 37CONQCh. 13 - 1. In the experiment of Figure 13.7, what would be...Ch. 13 - 2. Polypeptides can be translated in vitro. Would...Ch. 13 - Discuss how the elucidation of the structure of...Ch. 13 - Describe the structure of a polysome, which is...Ch. 13 - Prob. 5EQCh. 13 - 6. The technique of Western blotting is described...Ch. 13 - The protein known as tyrosinase is needed to make...Ch. 13 - Prob. 8EQCh. 13 - Discuss why you think the ribosomes need to...Ch. 13 - 2. Discuss and make a list of the similarities...Ch. 13 - 3. Which events during translation involve...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
Use the table to answer:
A portion of an mRNA attached to a ribosome reads:
5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′
If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid?
What is the last amino acid in this polypeptide?
Which amino acid will be the most frequent in the polypeptide?
arrow_forward
Use your genetic code (codon) table to answer this question:
A tRNA has the anticodon GCU. Which amino acid is attached to it?
A) alanine
B) methionine
C) arginine
D) threonine
E) serine
arrow_forward
The law of complementary base pairingdescribes the way the bases in an mRNAcodon pair up with the bases of a tRNAanticodon during translation.
arrow_forward
Draw a simple schematic of a tRNA molecule showing its two "business" ends.
arrow_forward
a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends.
b. translate this RNA sequence in 1a into a protein sequence
c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends.
d. Translate this RNA sequence in 1c into a protein sequence
arrow_forward
How do we call the type of point mutation in which an A->U change occurs in the codon for the sixth amino acid in hemoglobin chain b? a) Inversion b) Transversion c) Transition d) Transamination
arrow_forward
What is the role of transcription in the determination of the amino acid sequence of a polypeptide chain?
A.
It pairs anticodons and codons.
B.
It synthesizes an mRNA strand.
C.
It duplicates the information in DNA.
D.
It decodes the information from mRNA.
arrow_forward
In the chain elongation of proteins, the new aminoacyl-tRNA bonds to?
a.A site
b.E site
c.G site
d.P site
arrow_forward
If the sequence in the coding strand of DNA for a particular amino acid is 5'AGT3', then the anticodon on the corresponding tRNA would be ? Explain how to do this
arrow_forward
Use your genetic code (codon) table to answer the next two questions:
What type of mutation would result if the sequence of a gene were altered so that the sequence of the mRNA was changed from:
AUGCCGUGCAGUAAC to AUGCCAUGCAGUAAC
A) a silent mutation
B) a nonsense mutation
C) a frame-shift mutation
D) a missense mutation
E) a base insertion mutation
arrow_forward
An anticodon of tRNA has the sequence GCA. What amino acid does this tRNA carry?
HINT: you use mRNA codons to read the genetic code chart.
arrow_forward
Give typing answer with explanation and conclusion
Which of the triplets below is a possible anticodon for a tRNA that transports proline to a ribosome? Use your genetic code.
Group of answer choices
3′-UUC-5′
3′-CCG-5′
3′-GGC-5′
3′-CCC-5′
arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY