Biology
12th Edition
ISBN: 9780134813448
Author: Audesirk, Teresa, Gerald, Byers, Bruce E.
Publisher: Pearson,
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13.4, Problem 1CSC
Summary Introduction
To describe: The way in which functional chloride channel (CFTR protein) can produce CFTR alleles that cause cystic fibrosis.
Introduction: Cystic fibrosis is a genetic disorder that causes severe damage to the lungs, pancreas,
Summary Introduction
To describe: The way in which a gene can affect the timing and rate of transcription and translation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which of the following mutations would be most likely to have the most negative effect on the functioning of a protein produced by the gene?
Group of answer choices
a deletion of one nucleotide at the beginning of the coding sequence
a substitution of one nucleotide at the beginning of the coding sequence
an insertion of three nucleotides near the end of the coding sequence
a substitution of one nucleotide near the end of the coding sequence
A disease is caused by having no functional protein produced from the kip gene. An individual has this disease but has no mutation in the kip gene. You look at other gene candidates that could result in no functional kip protein. A gene called D5 codes for a methyltransferase that methylates the kip promoter region. A gene called T3 codes for an acetylase that acetylates the histones in the region of the kip gene.
Fill in the following blanks. In the situation described above, in which no kip protein is made, it is likely that the D5 gene has a mutation that ___________ the D5 protein or that the T3 gene has a mutation that ___________the T3 protein.
Blanks can either be deactivates or activates
Which of the following is NOT a DIFFERENCE between prokaryotic and eukaryotic gene regulation?
A. prokaryotic mRNA is NOT capped by a 5’mG after transcription, but eukaryotic mRNA is so capped
B. eukaryotic mRNAs are monocistronic (encode single proteins), whereas prokaryotic mRNAs are polycistronic (encode multiple proteins)
C. prokaryotic mRNA is not modified by polyadenylation after transcription, but eukaryotic mRNA is so modified.
D. translation of eukaryotic mRNA into protein is not coupled to transcription of the mRNA from DNA, but in prokaryotes it is so coupled
E. prokaryotic translation and eukaryotic translation use different genetic codes to translate mRNA codons into amino acid sequences of proteins
Chapter 13 Solutions
Biology
Ch. 13.1 - describe three types of RNA that play roles in...Ch. 13.1 - Prob. 2CYLCh. 13.1 - Prob. 3CYLCh. 13.2 - Prob. 1TCCh. 13.2 - Prob. 1CYLCh. 13.2 - Prob. 2CYLCh. 13.2 - describe an example of post-transcription...Ch. 13.3 - Prob. 1TCCh. 13.3 - Prob. 1CSCCh. 13.3 - Prob. 1CYL
Ch. 13.3 - Prob. 2CYLCh. 13.3 - Prob. 3CYLCh. 13.3 - Prob. 4CYLCh. 13.4 - Prob. 1CSCCh. 13.4 - describe three different types of mutations?Ch. 13.4 - Prob. 2CYLCh. 13.5 - Prob. 1HYEWCh. 13.5 - Envision yourself as a physician. A mother,...Ch. 13.5 - Prob. 2TCCh. 13.5 - Prob. 1CYLCh. 13.5 - Prob. 2CYLCh. 13.5 - Prob. 3CYLCh. 13.5 - Prob. 4CYLCh. 13.5 - Prob. 1CTCh. 13 - Prob. 1MCCh. 13 - Which of the following is not true of RNA? a. It...Ch. 13 - Prob. 3MCCh. 13 - Prob. 4MCCh. 13 - Prob. 5MCCh. 13 - Synthesis of RNA from the instructions in DNA is...Ch. 13 - Prob. 2FIBCh. 13 - Prob. 3FIBCh. 13 - Prob. 4FIBCh. 13 - Prob. 5FIBCh. 13 - If a nucleotide is replaced by a different...Ch. 13 - Prob. 1RQCh. 13 - Name the three types of RNA that are essential to...Ch. 13 - Prob. 3RQCh. 13 - Prob. 4RQCh. 13 - Prob. 5RQCh. 13 - Prob. 6RQCh. 13 - Prob. 7RQCh. 13 - Define mutation. Describe four different effects...Ch. 13 - Prob. 1ACCh. 13 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following mutations would likely have the greatest negative impact on the protein product of a gene? Group of answer choices a single base deletion close to the end of the coding region of a gene a single base insertion just after the start of the coding region of the gene a deletion of three bases near the middle of the gene a base-pair substitutionarrow_forward"The gene for Receptor Z contains an unknown number of untranslated first exons that are spliced to a common exon 2" - what does it mean if a "first exon" is "spliced to a common exon 2"? Does it mean that Exon 1 is attached to Exon 2, but Exon 1 is not part of the translated protein - similar to the below schematic? mRNA Option 1: [Exon 1a][Exon 2][Exon 3].... mRNA Option 2:[Exon1b][Exon2][Exon 3] mRNA Option 3: [Exon1c][Exon2][Exon 3]arrow_forwardWhich of the following mutations would not convert a proto-oncogene into an oncogene? A translocation that places the gene at a new locus where gene expression is increased. A mutation in the coding region that makes the protein resisitant to degradation. Gene duplication. A mutation in the coding region that makes the protein hyperactive. A deletion of an enhancer that lies 3’ to the coding region.arrow_forward
- Which of the following mutations would have the greatest negative impact on the protein product of a gene? A. a single base deletion close to the end of the coding region of a gene. B. a single base insertion near the start of the coding region of the gene C. a base-pair substitution D. a deletion of three bases near the middle of the genearrow_forwardWhich of the following is likely associated with the mRNA processing step of alternative splicing? 1. A gene is discovered to encode for two different proteins one protein has 46 amino acids and the other protein has 86 amino acid 2. A gene has 7 exons. one processed mRNA transcript from this gene contains exons 3, 4, 6 and 7. a second process mRNA transcript from this gene contains exons 2, 3, 5, and 7 3. The open reading frame of a gene contains 90 nucleotides but the translated polypeptide contains only 29 amino acids 4. Complexity of the transcrptome ( # of different mRNA molecules) increasesarrow_forwardWhat is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?arrow_forward
- The length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides, whereas the length of the mRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference?arrow_forwardThe asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the second intron of a eukaryotic gene. Due to this mutation, the second intron is now not ‘spliced out’ during the splicing process. What are the most likely consequences of this mutation with respect to the size of the pre-mRNA and the size of the mature mRNA? a. The pre-mRNA will be longer and the mature mRNA will be longer. b. The pre-mRNA will be longer and the size of the mature mRNA will not be affected c. The size of the pre-mRNA will not be affected and the mature mRNA will be longer d. The size of the pre-mRNA will not be affected and the size of the mature mRNA will not be affectedarrow_forwardNonfunctional HexA protein is responsible for the autosomal recessive disease Tay Sachs. A patient with Tay Sachs produces a normal amount of full length but non-functional HexA protein. Of the choices below, what is the most likely type of mutation responsible for the disease? a) base substitution in an intron 5' splice site b) frameshift in an exon c) missense in an exon d) base substitution in an enhancer regionarrow_forward
- Would a gain of function mutaion that occurs in the first exon of a gene with twelve exons more likely be missense or nonsense? Briefly explain your choice. List one disease that we studied in class that is due to a gain of function.arrow_forwardIf the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation causes a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?arrow_forwardWhat percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY