The fact that the evolutionary relationship of the amino acid sequences of the DNA polymerases found in Archaea show great similarity to Eukaryote but show little similarity to those of the DNA polymerases of bacteria. Introduction: DNA polymerases are the enzymes that carry out the process of DNA replication in all living cells. These enzymes are proteins; so, all DNA polymerases are made up of various combinations of polypeptides, which again, are made up of various combinations of amino acid sequences.

Question

A researcher sequences the genome of a variety of bacterial and eukaryotic cells. She finds that the bacterial genome is smaller, but that there are more genes for a given number of base pairs in the eukaryotic cells. In other words, there are fewer genes per unit of length of DNA in the eukaryotic cells. What do you predict she will find if she examines the DNA more closely? A. All of the bacterial DNA consists of coding sequences, but this is not true of the eukaryotic DNA. B. There are more repetitive sequences in the eukaryotic DNA than in the bacterial DNA. C. There are densely packed genes in the eukaryotic DNA that were not immediately distinguishable during the first analysis. D. The bacteria have larger quantities of noncoding DNA than the eukaryotic cells.

Answer 1

Question

Chapter 14, Problem 16TYK

Summary Introduction

To review:

The fact that the evolutionary relationship of the amino acid sequences of the DNA polymerases found in Archaea show great similarity to Eukaryote but show little similarity to those of the DNA polymerases of bacteria.

Introduction:

DNA polymerases are the enzymes that carry out the process of DNA replication in all living cells. These enzymes are proteins; so, all DNA polymerases are made up of various combinations of polypeptides, which again, are made up of various combinations of amino acid sequences.

Expert Solution & Answer

Trending nowThis is a popular solution!

See solution

Check out sample textbook solution

Students have asked these similar questions

A researcher sequences the genome of a variety of bacterial and eukaryotic cells. She finds that the bacterial genome is smaller, but that there are more genes for a given number of base pairs in the eukaryotic cells. In other words, there are fewer genes per unit of length of DNA in the eukaryotic cells. What do you predict she will find if she examines the DNA more closely? A. All of the bacterial DNA consists of coding sequences, but this is not true of the eukaryotic DNA. B. There are more repetitive sequences in the eukaryotic DNA than in the bacterial DNA. C. There are densely packed genes in the eukaryotic DNA that were not immediately distinguishable during the first analysis. D. The bacteria have larger quantities of noncoding DNA than the eukaryotic cells.

Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)

DNA polymerases cannot act as primers for replication, yet primase and other RNA polymerases can. Some geneticists have speculated that the inability of DNA polymerase to prime replication is a result of its proofreading function. This hypothesis argues that proofreading is essential for the faithful transmission of genetic information and that because DNA polymerases have evolved the ability to proofread, they cannot prime DNA synthesis. Explain why proofreading and priming functions in the same enzyme might be incompatible.