Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 14, Problem 1NST
Summary Introduction
To determine: The inference from the given experiment.
Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C14-cysteinyl-tRNACys. They further removed the sulfur group from the cysteine and created alanyl-tRNACys. When alanyl-tRNACys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.
Expert Solution & Answer
Explanation of Solution
As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNACys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.
Conclusion
Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.
Want to see more full solutions like this?
Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Consider the following mRNA base sequence
5' CUG-CAC 3'
(a) What dipeptide is coded for by this mRNA?
(b) What dipeptide is formed if a mutation converts CUG to CUU?
(c) What dipeptide is formed if a mutation converts CAC to CGC?
(d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?
A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP. Where will the radioactive isotope appear in mature mRNA if the ATP is labeled at the (a) α position, (b) β position, and (c) γ position?
Consider this sequence below:
GAG TAC ACG AGT GGA
Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!)
A. GAG TAC AAT CGA GTG GA
B. GAG TAC ACG GGT GGA
C. GAG TAC A–G AGT GGA
D. GAG TAC ACG AGA GGA
Chapter 14 Solutions
Concepts of Genetics (12th Edition)
Ch. 14 - Prob. 1NSTCh. 14 - A series of mutations in the bacterium Salmonella...Ch. 14 - HbS results from the substitution of valine for...Ch. 14 - Given that a faulty ribosomal protein is the...Ch. 14 - A couple with a child affected with DBA undergoes...Ch. 14 - Prob. 3CSCh. 14 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 14 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 14 - Contrast the roles of tRNA and mRNA during...Ch. 14 - Francis Crick proposed the adaptor hypothesis for...
Ch. 14 - During translation, what molecule bears the codon?...Ch. 14 - The chain of eukaryotic hemoglobin is composed of...Ch. 14 - Assuming that each nucleotide in an mRNA is 0.34...Ch. 14 - Summarize the steps involved in charging tRNAs...Ch. 14 - To carry out its role, each transfer RNA requires...Ch. 14 - What are isoaccepting tRNAs? Assuming that there...Ch. 14 - When a codon in an mRNA with the sequence 5-UAA-3...Ch. 14 - Discuss the potential difficulties of designing a...Ch. 14 - Prob. 13PDQCh. 14 - Prob. 14PDQCh. 14 - The synthesis of flower pigments is known to be...Ch. 14 - The study of biochemical mutants in organisms such...Ch. 14 - Explain why the one-gene: one-enzyme concept is...Ch. 14 - Why is an alteration of electrophoretic mobility...Ch. 14 - Prob. 19PDQCh. 14 - Prob. 20PDQCh. 14 - Prob. 21PDQCh. 14 - Prob. 22PDQCh. 14 - Several amino acid substitutions in the and ...Ch. 14 - Define and compare the four levels of protein...Ch. 14 - What are the two common types of protein secondary...Ch. 14 - How do covalent disulfide bonds, hydrogen bonds...Ch. 14 - Prob. 27PDQCh. 14 - List three different types of posttranslational...Ch. 14 - Prob. 29PDQCh. 14 - How does an enzyme function? Why are enzymes...Ch. 14 - Prob. 31PDQCh. 14 - Three independently assorting genes (A, B, and C)...Ch. 14 - How would the results vary in cross (a) of Problem...Ch. 14 - Deep in a previously unexplored South American...Ch. 14 - Many antibiotics are effective as drugs to fight...Ch. 14 - The flow of genetic information from DNA to...Ch. 14 - Prob. 37ESP
Knowledge Booster
Similar questions
- Human wildtype and mutant alleles are identical in sequence except for a single base-pair substitution that changes one nucleotide towards the end of intron 2. The wildtype and mutant sequences of the affected portion of the mRNA are listed in the following table. Explain how a single base substitution could alter the reading frame, which could result in a physiological disorder?arrow_forwardThe following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?arrow_forwardThe wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids? A. Leucine B. Methionine C. Serinearrow_forward
- Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardA synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the following amino acid sequence: Met-ProIle-Ser-Ala. What would be the effect on translation if the following component were omitted from the cell-free protein-synthesizing system? What, if any, type of protein would be produced? Explain your reasoning. Q.Release factors RF-1, RF-2, and RF-3arrow_forwardThe hypothetical mRNA sequence below contains the coding region for a short peptide. What consequence for this peptide does the substitution of the uracil at position 28 of the mRNA with guanine have? GGUUGAAUGGAACAACGCGUGCACCCUUAGAGGUAACCCUCC | G Group of answer choices No consequence, it is a silent mutation. It shortens the peptide by two amino acids. It destroys the start codon of the peptide coding region. It extends the peptide by two amino acid. It replaces one of the original amino acids of the protein with a different one.arrow_forward
- What polypeptide sequences would you expect to result from a synthetic mRNA with the repeating sequence 5’-UUUGGGUUUGGGUUUGGG-3'?arrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardYou start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine – because Yanofsky recovered it in his screen, that means that having an Arginine in this position does not allow the TrpA gene to function properly. Assuming that this particular mutation induced by Yanofsky was a single nucleotide change, what are the possible codons of Leucine that could be found at this position in wild-type TrpA? What are the possible codons for Leucine that could be found in the mutant?. If you took this mutant E. Coli line (that has an Arginine at this location) and exposed it to a mutagen that could potentially change bases, what are the second mutations you would most likely discover that would restore the activity of the tryptophan synthetase gene and where would it be located?arrow_forward
- You start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine – because Yanofsky recovered it in his screen, that means that having an Arginine in this position does not allow the TrpA gene to function properly. Assuming that this particular mutation induced by Yanofsky was a single nucleotide change, what are the possible codons of Leucine that could be found at this position in wild-type TrpA? What are the possible codons for Leucine that could be found in the mutant?arrow_forwardTwo missense mutations in the gene that encodes an enzyme called superoxide dismutase cause a form of amyotrophic lateral sclerosis (ALS, or Lou Gehrig disease). This disease causes loss of neurological function over a 5-year period. One mutation alters the amino acid asparagine (Asn) to lysine (Lys). The other changes an isoleucine (Ile) to a threonine (Thr). List the codons involved and describe how single-base mutations can alter the specified amino acids.arrow_forwardA mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. a)Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. b)Are all the mRNAs affected by the rho protein mutation in the same way? Why or why not?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning