Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 26CTQ
Prokaryotes have a single circular chromosome while eukaryotes have linear chromosomes. Describe one advantage and one disadvantage to the eukaryotic genome packaging compared to the prokaryotes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Prokaryotes have a single circular chromosome while eukaryotes have linear chromosomes. Describe one advantage and one disadvantage to the eukaryotic genome packaging compared to the prokaryotes.
Even though the eukaryotic genome is thousands of times larger than the prokaryotic genome, DNA replication times are relatively similar. Explain how this is possible.
Why the DNA sequencing alone is often not sufficient to produce a genome assembly of desired reference-grade quality, particularly in eukaryotic organisms?
Chapter 14 Solutions
Biology 2e
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
In a slap shot, a hockey player accelerates the puck from a velocity of 8.00 m/s to 40.0 m/s in the same direct...
College Physics
The following diagram illustrates passive and active transport across a plasma membrane. Use it to answer quest...
Study Guide for Campbell Biology
21-Year-Old Female with Skeletal Injuries
While riding her bike to campus, 21-year-old Liliana Rose was struck...
Human Anatomy & Physiology (11th Edition)
In shorthorn cattle, coat color may be red, white, or roan. Roan is an intermediate phenotype expressed as a mi...
Concepts of Genetics (12th Edition)
1. ___ Mitosis 2. ___ Meiosis 3. __ Homologous chromosomes 4. __ Crossing over 5. __ Cytokinesis A. Cytoplasmic...
Microbiology with Diseases by Body System (4th Edition)
If someone at the other end of a room smokes a cigarette, you may breathe in some smoke. The movement of smoke ...
Campbell Essential Biology with Physiology (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A major difference between prokaryotes and eukaryotes is the presence of a nucleus. What advantages and disadvantages may occur with having a cell’s genome packaged in a nucleus?arrow_forwardnon-coding DNAs can be put into two groups, name themarrow_forwardHuman genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving human DNA with Haeiii in such a way that the DNA is only partially digested; that is, not all the possible HaeIII sites have been cleaved. What is a possible reason for doing this?arrow_forward
- In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strandarrow_forwardWith a few exceptions, interspersed repetitive DNA in the human genome has no known biological function. Explain in a few sentences what interspersed means. Name and describe one interspersed repetitive element. Provide information on about how much of the human genome consists of this one repetitive element (copy number and/or percent of genome).arrow_forwardWhat is the real definition of DNA ligase to make it truearrow_forward
- Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHarrow_forwardBelow is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?arrow_forwardYou were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below. 5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region 3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region After several tries, you obtained a beautiful sequencing image as shown here: The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline: Tm is 55 – 60°C. Ensures primer had a appropriate melting temperature for PCR ans sequencing. The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%). A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA. The secondary structure of the primer must be none or weak. No primer dimers (The primer anneals to itself). 3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet…arrow_forward
- In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?arrow_forwardThe telomeres of a linear chromosome are made of identical directly repeated DNA sequences. How does the enzyme telomerase generate these DNA repeats?arrow_forwardRestriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License