Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 14, Problem 26P
Interpretation Introduction
To propose:
The position of HIV-1 protease cleavage site according to its active model.
Introduction:
HIV-1 protease is also known by the name of retroviral aspartyl protease. It is a retro-pepsin which is vital in the life cycle of HIV (human immune virus).
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Chapter 14 Solutions
Biochemistry
Ch. 14 - Answers to all problems are at the end οΓthis...Ch. 14 - Answers to all problems are at the end οΓthis...Ch. 14 - Prob. 3PCh. 14 - Prob. 4PCh. 14 - Answers to all problems are at the end οΓthis...Ch. 14 - Prob. 6PCh. 14 - Prob. 7PCh. 14 - Answers to all problems are at the end οΓthis...Ch. 14 - Answers to all problems are at the end οf this...Ch. 14 - Answers to all problems are at the end οf this...
Ch. 14 - Answers to all problems are at the end of this...Ch. 14 - Answers to all problems are at the end οΓthis...Ch. 14 - Answers to all problems are at the end οΓthis...Ch. 14 - Prob. 14PCh. 14 - Prob. 15PCh. 14 - Prob. 16PCh. 14 - Prob. 17PCh. 14 - Prob. 18PCh. 14 - Answers to all problems are at the end οΓthis...Ch. 14 - Answers to all problems are at the end οΓthis...Ch. 14 - Answers to all problems are at the end οΓthis...Ch. 14 - Prob. 22PCh. 14 - Prob. 23PCh. 14 - Prob. 24PCh. 14 - Prob. 25PCh. 14 - Prob. 26P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Preparing cDNA Libraries from Different Cells Describe an experimental protocol for the preparation of to cDNA libraries, one from anaerobically grown yeast cells and the second from aerobically grown yeast cell.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. An Estimation of the Number of Cenes in a Virus Virus genomesrange in size from approximately nucleotides to approximately 280,000 base pairs. If viral genes are about the same size as M. genilalium genes, what is the minimum and maximum number of genes in viruses? (Section 1.5)arrow_forwardAnswers to all problems are at the end οΓthis book. Detailed solutions are available in the Student Solutions Manual. Study Guide, and Problems Book. Superbug infections are becoming more common around the world. Many of these infections arise from the action of -lactamases, of which there are several types with different mechanisms of action. Consult the end-of-chapter reference by von Nussbaum and Schiffer and write detailed mechanisms for the serine -lactamases and metallo- -lactamases.arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. CRISPR/Cas9: Design of a gRNA to Target the Human PVALB Gene The human PVALB gene, which encodes the Ca2+-binding protein parvalbumin, can be Targeted by CRISPR/Cas9, at the protospacer sequence - ATGCAGGAGGGTGGCGAGAGGGGCCGAGAT- followed by a -TGG-PAM trinucleotide. Give the sequence of the spacer region of a gRNA that will target the complementary DNA strand at this site. Include at the 3'-end of your gRNA sequence a region that will form a stem-loop structure with a 5'-AGCAUAGCUGUAAAAC- sequence downstream in the gRNA to create the dsRNA-binding site for Cas9.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Abundance of the Different Bases in the Human Genome Results on the human genome published in Science (Science 291 :1304—1350 [2001]) indicate that the haploid human genome consists of 2.91 gigabase pairs (2.91 X ]09 base pairs} and that 27% of the bases in human DNA are A. Calculate the number of A. T, G, and C residues in a typical human cell.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Sequence Relationship Between an Antisense RNA Strand and Its Template DNA Strand The DNA strand that is complementary to the template strand copied by RNA polymerase during transcription has a nucleotide sequence identical to that of the RNA being synthesized (except T residues are found in the DNA strand at sites where U residues occur in the RNA). An RNA transcribed from this nontem-plate DNA strand would be complementary to the mRNA synthesized by RNA polymerase. Such an RNA is called antisense RNA because its base sequence is complementary to the “sense mRNA. One strategy to thwart the deleterious effects of genes activated in disease slates (such as cancer) is to generate antisense RNAs in affected cells. These antisense RNAs would form double-stranded hybrids with mRNAs transcribed from the activated genes and prevent their translation into protein. Suppose transcription of a cancer-activated gene yielded an mRNA whose sequence included the segment 5’-UACGUCUAAGCUGA. What is the corresponding nucleotide sequence (5’ The template strand in a DNA duplex that might be introduced into these cells so that an untisense RNA could be transcribed from it?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. An Estimation of Minimal Genome Size for a Living Cell Studies of existing cells to determine the minimum number of genes for a living cell have suggested that 206 genes are sufficient. If the ratio of protein-coding genes to non-protein-coding genes is the same in this minimal organism as the genes of Mycoplasma genitulium, how many proteins are represented in these 206 genes. How many base pairs would be required to form the genome of this minimal organism if the genes are the same size as M genilalium genes? (Section 1.5)arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. A Simple Genome and Its Protein-Encoding Capacity The genome of the Mycoplasma genitalium consists of 523 genes, encoding 484 proteins, in just 5S0.U74 base pairs (see Table 1.6). What fraction of the M. genitalium genes encode proteins? What do you think the other genes encode? If the fraction of base pairs devoted to protein-coding genes is the same as the fraction of the total genes that they represent, what is tlie average number of base pairs per protein-coding gene? If it takes three base pairs to specify an amino acid in a protein, how many amino acids are found in the average M. genitalium protein? If each amino acid contributes, on average, 12U daltons to the mass of a protein, what is the mass of an average M. genitalium protein? (Section 1.5)arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Deducing DNA Sequence from Sanger Sequencing Results The output of an automated DNA sequence determination by the Sanger dideoxy chain termination method, performed as illustrated in Figure 11.3, is disp1ayed at right. What is the sequence of the original oligonucleotide?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence (53)ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Consider the following peptide sequences: EANQIDEMLYNVQCS LTTLE DTVPW LG VHLDITVPL SWTWTLYVKL QQNWGGLWILTLVWFLM CNMKHGDSQCDERTYP YTREQSDGHIPKMNCDS AGPFGPDGPTIGPK Which of the preceding sequences would be likely to be found in each of the following: A parallel -sheet An antiparallel -sheet A tropocollagen molecule The helical portions of a protein found in your hairarrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Relationship Between the Nucleotide Sequence of an mRNA and the DNA Strand from Which It Is Transcribed Messenger RNAs are synthesized by RNA polymerases That read along a DNA Template strand in The 3' 5' direction, polymerizing ribonucleotides in The 5' 3r direction (see Figure 10.20). Give the nucleotide sequence (5r 3') of the DNA template strand from which The following rnRNA segment was transcribed: 5'-LAGL GAC AGUUGCGAU-3'.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY