BIOLOGY 12E CONNECT ACCESS CARD
12th Edition
ISBN: 9781264938513
Author: Raven
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 6A
Successful DNA synthesis requires all of the following except
a. helicase.
b. endonuclease.
c. DNA primase.
d. DNA ligase.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
List the stage of DNA replication when each of the following enzymes is active. a. helicase b. primase c. DNA polymerases d. ligase e. topoisomerase f. DNA gyrase
The function of DNA ligase is to:
a. Catalyze formation of phosphodiester bonds between adjacent nucleotides
b. Catalyze formation of hydrogen bonds between adjacent nucleotides
c. Keep single strands of DNA apart during replication
d. Facilitate base pairing between single stranded molecules in DNA
e. Both a. and d. are correct
Indicate whether each of the following statements is true
or false. If a statement is false, explain why it is false.
A. The repair polymerase is the enzyme that proofreads the newly synthesized
strands to ensure the accuracy of DNA replication.
B. There is a single enzyme that degrades the RNA primers and lays down the
corresponding DNA sequence behind it.
C. DNA ligase is required to seal the sugar-phosphate backbone between all the
DNA fragments on the lagging strand.
D. The repair polymerase does not require the aid of the sliding clamp, because it is
only synthesizing DNA over very short stretches.
Answer the following questions about DNA replication.
On a DNA strand that is being synthesized, which end is growing the 3' end, the 5' end,
or both ends? Explain your answer.
А.
B. On a DNA strand that is being used as a template, where is the copying occurring relative
to the replication origin-3' of the origin, 5', or both?
Chapter 14 Solutions
BIOLOGY 12E CONNECT ACCESS CARD
Ch. 14.1 - Describe the experiments of Griffith and Avery.Ch. 14.1 - Evaluate the evidence for DNA as genetic material.Ch. 14.2 - Explain how the WatsonCrick structure rationalized...Ch. 14.2 - Prob. 2LOCh. 14.3 - Prob. 1LOCh. 14.3 - Prob. 2LOCh. 14.4 - Prob. 1LOCh. 14.4 - Prob. 2LOCh. 14.4 - Diagram the functions found at the replication...Ch. 14.5 - Compare eukaryotic replication with prokaryotic.
Ch. 14.5 - Prob. 2LOCh. 14.5 - Prob. 3LOCh. 14.6 - Prob. 1LOCh. 14.6 - Prob. 2LOCh. 14 - Prob. 1DACh. 14 - Prob. 2DACh. 14 - Prob. 1IQCh. 14 - Prob. 2IQCh. 14 - How does the structure of eukaryotic genomes...Ch. 14 - Prob. 4IQCh. 14 - Prob. 1UCh. 14 - Which of the following is NOT a component of DNA?...Ch. 14 - Chargaff studied the composition of DNA from...Ch. 14 - The bonds that hold two complementary strands of...Ch. 14 - Prob. 5UCh. 14 - Prob. 6UCh. 14 - Which of the following is NOT pan of the...Ch. 14 - If one strand of a DNA is 5 ATCGTTAAGCGAGTCA 3,...Ch. 14 - Hershey and Chase used radioactive phosphorus and...Ch. 14 - The Meselson and Stahl experiment used a density...Ch. 14 - Prob. 4ACh. 14 - If the activity of DNA ligase was removed from...Ch. 14 - Successful DNA synthesis requires all of the...Ch. 14 - The synthesis of telomeres a. uses DNA polymerase,...Ch. 14 - When mutations that affected DNA replication were...Ch. 14 - Prob. 1SCh. 14 - In the Meselson-Stahl experiment, a control...Ch. 14 - Enzyme function is critically important for the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 5) In DNA replication, which of the following events happens during both leading and lagging strand synthesis? a. RNA primers help initiate DNA synthesis. b. Topoisomerase separates complementary strands of DNA. c. Ligase joins together multiple Okazaki fragments. d. DNA polymerase synthesizes a single, continuous strand of DNA. Explain WHY? 6) Suppose you are provided with an actively dividing culture of E. coli bacteria to which radioactive thymine has been added. What would happen if a cell replicates once in the presence of this radioactive base? a. One of the daughter cells, but not the other, would have radioactive DNA. b. Neither of the two daughter cells would be radioactive. c. All four bases of the DNA would be radioactive. d. DNA in both daughter cells would be radioactive. Explain WHY?arrow_forwardWhich of the following statements are TRUE?I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand.II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′-triphosphate.IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotide a. I only b. II only c. I and IV d. III and IVarrow_forwardWhich of the following statements are TRUE?I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand.II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′-triphosphate.IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotidearrow_forward
- Which of the following enzymes is NOT involved in DNA replication? a. DNA Polymerase b. Primase c. Helicase d. Phosphatase e. DNA Ligasearrow_forwardWhich of the following enzymes is responsible for ensuring that genetic material at the end of the chromosome is not lost during DNA replication? a. Helicase b. DNA Polymerase c. Telomerase d. DNA Ligase e. Primasearrow_forwardWhich of the following enzymes is responsible for "exposing" or "unwinding" the DNA template (taking it out of its double helix) for DNA Replication? a. Topoisomerase b. Telomerase c. DNA Ligase d. Primase e. Helicasearrow_forward
- Which of the following statements is TRUE concerning the synthesis of the leading and lagging strands of DNA in prokaryotic cells? a. O b. The leading strand is synthesized by one polymerase III continuously, and the lagging strand is synthesized by several molecules of DNA polymerase III. d. The leading and lagging strands are synthesized at the same time by the one DNA polymerase I. O c. The leading and lagging strands are synthesized at the same time by the one DNA polymerase III. The leading strand is synthesized by one polymerase III, and the lagging strand is synthesized by DNA polymerase I.arrow_forwardEnzyme function is critically important for the proper replication of DNA. Predict the consequence of a loss of function for each of the following enzymes. a. DNA gyrase b. DNA polymerase III c. DNA ligase d. DNA polymerase Iarrow_forwardWhich of the following statements about the processes of the central dogma is/are incorrect? I. Replication occurs only once during the life cycle of a cell. II. The entire sequence of a DNA molecule carries instructions for the synthesis of proteins and nucleic acids. III. The products of transcription all eventually undergo translation. IV. Transcription and replication both involve the use of RNA molecules. V. The translation of the genetic code is directly based on the sequence of the template DNA strand. O , I, and V O II, II, and V O l and IV O II, II, and IV O Only l is incorrectarrow_forward
- The enzyme responsible for adding new nucleotides to a growing DNA chain during DNA replication is a. helicase. b. RNA polymerase. c. DNA polymerase. d. DNA ligase.arrow_forwarda. unwinds the DNA helix b. stabilizes and stops the two strands from annealing (rebinding with each other) c. recoils the DNA d. cleaves both strands of DNA to relieve tension at supercoils e. places RNA primers at their proper location on the template strands f. acts as starting points for DNA polymerase g. adds DNA nucleotides to form new DNA strands h. forms phosphodiester bonds to join Okazaki fragments Esc 1. single-strand binding protein 2. helicase 3. DNA ligase 4. RNA primer 5. gyrase 6. DNA polymerase 53°F Cloudy 3 Q Search $ F5 FRarrow_forwardTake each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY