Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 21CTQ
A scientist sequencing itiRNA identifies the following strand:
CUAUGUGUCGUAACAGCCGAUGACCCG
What is the sequence of the amino acid chain this itiRNA makes when it is translated?
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
A scientist while sequencing mrna identifies the following strand cugucaguacuaagagucgaugacgcgggguuuac what is sequence of amino acid chain this mRNA makes when it is translated?
A scientist sequencing mRNA identifies the following strand: AUAUAUACUAUCAUGUAAUAUGUGUCGUAACAGCCGAUGACCCGWhat is the sequence of the amino acid chain this mRNA makes when it is translated?
The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start codon, what is the third amino acid incorporated into the polypeptide chain?
Chapter 15 Solutions
Biology 2e
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
The planetary model of the atom pictures electrons orbiting the atomic nucleus much as planets orbit the Sun. I...
College Physics
If someone at the other end of a room smokes a cigarette, you may breathe in some smoke. The movement of smoke ...
Campbell Essential Biology with Physiology (6th Edition)
25. Blue moon beans produce beans that are either the domi-nant color blue or the recessive color white. The be...
Genetic Analysis: An Integrated Approach (3rd Edition)
Define histology.
Fundamentals of Anatomy & Physiology (11th Edition)
2. Whether an allele is dominant or recessive depends on
a. how common the allele is, relative to other alleles...
Campbell Biology: Concepts & Connections (9th Edition)
1. Which trophic level(s) must be present to sustain any ecosystem?
a. producers only
b. producers and consume...
Biology: Life on Earth (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fivearrow_forwardIf a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA transcription and translation what would be the amino acid sequence of the product?arrow_forwardWhat is the tRNA strand for the following mRNA strand: CAGGAUGAAUUGCUCarrow_forward
- The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this gene code for? The top is the coding strand. 5' GGCTATGTATAGGGTAAACTTCTGACGCCTA 3' 3’ CCGATACATATCCCATTTGAAGACTGCGGAT 5’arrow_forwardWhat will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5' TEMPLATE STRAND 5' TAGCCAATTG 3' CODING STRAND 1. 5' AUCGGUUAAC 3' 2. 3' GUUAAGGCAU 5' 3. 3' GUUAACCGAU 5’ 4. 5' UAGCCUUAAC 3'arrow_forwardA template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What amino acids are encoded by this sequence?arrow_forward
- A strand of DNA, TACGCT, serves as a template for mRNA transcription. What would be the correct sequence of mRNA transcribed from this DNA template? ATGCGA UACGCU AUGCGA TACGCTarrow_forwardWhat is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3' sequence? a5'-ATCGGATTC-3' b5'-GAAUCCGAU-3' c5'-GAATCCGAT-3' d5'-UAGCCUAAG-3'arrow_forwardUsing the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.arrow_forward
- A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence? 5′ –ATGATACTAAGGCCC–3′arrow_forwardThe following base sequence is a complete polynucleotide made in a bacterial cell. AUG, GCC, AUG, GUU, AAA, CCC, GGA, GGG, UGA How many codons will be transcribed in the mRNA made from the template DNA strand and the tRNA anticodons that correspond with this sequence.arrow_forwardWhat would be the effect on reading frame and gene function if: Two bases were inserted into the middle of an mRNA? Three bases were inserted into the middle of an mRNA? One base was inserted into one codon? Two codons were subtracted from the first codon?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY