Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16, Problem 17RQ
An unprocessed pre-mRNA has the following structure.
Which of the following is not a possible size (in bp) of the mature mRNA?
- 205bp
- 180bp
- 150bp
- 100bp
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Which of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp d. 100bp
Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA sequence that would be produced?
TUTUCGUGUCTU
AUAUCGUGACUA
ATATCGTGACTA
CGCATGTCAGC
None of the above
What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’ poly- A tail? a. 220bp b. 295bp c. 140bp d. 435bp
Chapter 16 Solutions
Biology 2e
Ch. 16 - Figure 16.5 In E. coli, the tip operon is on by...Ch. 16 - Figure 16.7 In females, one of the two X...Ch. 16 - Figure 16.13 An increase in phosphorylation levels...Ch. 16 - Control of gene expression in eukaryotic cells...Ch. 16 - Post-translational control refers to: regulation...Ch. 16 - How does the regulation of gene expression support...Ch. 16 - If glucose is absent, but so is lactose, the lac...Ch. 16 - Prokaryotic cells lack a nucleus. Therefore, the...Ch. 16 - The a/a operon is an inducible operon that...Ch. 16 - What are epigenetic modifications? the addition of...
Ch. 16 - Which of the following are true of epigenetic...Ch. 16 - The binding of _____ is required for transcription...Ch. 16 - What will result from the binding of a...Ch. 16 - A scientist compares the promoter regions of two...Ch. 16 - Which of the following are involved in post...Ch. 16 - Binding of an RNA binding protein will the...Ch. 16 - An unprocessed pre-mRNA has the following...Ch. 16 - IS. Alternative splicing has been estimated to...Ch. 16 - Post-translational modifications of proteins can...Ch. 16 - A scientist mutates elF-2 to eliminate its GTP...Ch. 16 - Cancer causing genes are called transformation...Ch. 16 - Targeted therapies are used in patients with a set...Ch. 16 - Name two differences between prokaryotic and...Ch. 16 - Describe how controlling gene expression will...Ch. 16 - Describe how transcription in prokaryotic cells...Ch. 16 - What is the difference between a repressible and...Ch. 16 - In cancer cells, alteration to epigenetic...Ch. 16 - A scientific study demonstrated that rat mothering...Ch. 16 - Some autoimmune diseases show a positive...Ch. 16 - A mutation within the promoter region can alter...Ch. 16 - What could happen if a cell had too much of an...Ch. 16 - A scientist identifies a potential transcription...Ch. 16 - Describe how RBPs can prevent miRNAs from...Ch. 16 - How can external stimuli alter...Ch. 16 - Protein modification can alter gene expression in...Ch. 16 - Alternative forms of a protein can be beneficial...Ch. 16 - Changes in epigenetic modifications alter the...Ch. 16 - A scientist discovers a virus encoding a Protein X...Ch. 16 - New drugs are being developed that decrease DNA...Ch. 16 - How can understanding the gene expression pattern...
Additional Science Textbook Solutions
Find more solutions based on key concepts
At its peak, a tornado is 60.0 m in diameter and carries 500 km/h winds. What is its angular velocity in revolu...
College Physics
Level 2: Application/Analysis 4. Nitrifying bactcria participatc in the nitrogen cycle mainly by (A) converting...
Campbell Biology (11th Edition)
Raw Oysters and Antacids: A Deadly Mix? The highly acidic environment of the stomach kills most bacteria before...
Microbiology with Diseases by Body System (4th Edition)
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth
Which one of Mendel's laws describes the inheritance of alleles for a Single character? Which law relates to th...
Campbell Biology (10th Edition)
CAUTION How can evolutionary fitness be estimated? a. Document how long individuals survive. b. Count the numbe...
Biological Science (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. intronsarrow_forwardCompare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural differences.arrow_forwardGiven the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:arrow_forward
- A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).arrow_forwardGiven the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forwardIf the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fivearrow_forward
- Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of its protein product? 5'-AUGUGUUGAUGUAUCAGACCUGUC ---arrow_forwardHow would the deletion of the following sequences or features most likely affect a eukaryotic pre-mRNA? Q. Poly(A) tailarrow_forwardAs shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and six introns, which are numbered in green. A splicing repressor binds at the 3′ splice site at the end of intron 4, which is just before exon 5. What exons will be included in the mature mRNA?arrow_forward
- For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'arrow_forwardThe amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’arrow_forwardwhat does mature mRNA look like after processing? Include 5'cap, 5' UTR, +1 site, exons, 3' UTR, polyadenalation sequence, poly A tail.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College 
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY