Prescott's Microbiology
11th Edition
ISBN: 9781260211887
Author: WILLEY, Sandman, Wood
Publisher: McGraw Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 18.3, Problem 1CC
Retrieve, Infer, Apply
NGS techniques are considered well suited for metagenomics because a genomic library does not have to be constructed. Apart from convenience, explain why this is important for metagenomic analysis.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Expand PCR? Describe the different Steps involved in this technique?
Both microarray and RNA-sequencing can study the transcriptomes. Compare microarray and RNA sequencing technique in analyzing gene with high, medium and low copy number of genes.
Can you please provide pipeline for variant calling using bcftools for microbial genomes
asap
Chapter 18 Solutions
Prescott's Microbiology
Ch. 18.1 - MICRO INQUIRY What is the function of the 3-OH...Ch. 18.1 - MICRO INQUIRY Why is it important that identical...Ch. 18.2 - MICRO INQUIRY Which step (or steps) in this...Ch. 18.2 - Retrieve, Infer, Apply Why is the Sanger technique...Ch. 18.2 - Retrieve, Infer, Apply Explain the difference...Ch. 18.2 - Retrieve, Infer, Apply Why does reversible chain...Ch. 18.2 - Prob. 4CCCh. 18.2 - Retrieve, Infer, Apply Suggest a medical and an...Ch. 18.3 - Retrieve, Infer, Apply NGS techniques are...Ch. 18.3 - Retrieve, Infer, Apply Examine figure 18.8. How...
Ch. 18.4 - Prob. 1MICh. 18.4 - Prob. 1CCCh. 18.4 - Prob. 2CCCh. 18.4 - Prob. 3CCCh. 18.5 - Figure 18.12 Metabolic Pathways and Transport...Ch. 18.5 - Prob. 2MICh. 18.5 - Prob. 3MICh. 18.5 - Prob. 1CCCh. 18.5 - Retrieve, Infer, Apply How might the following...Ch. 18.5 - Retrieve, Infer, Apply Compare and contrast...Ch. 18.5 - Retrieve, Infer, Apply Why does two-dimensional...Ch. 18.5 - Retrieve, Infer, Apply What is the difference...Ch. 18.5 - Retrieve, Infer, Apply Describe a ChIP-Seq...Ch. 18.7 - Prob. 1MICh. 18.7 - Retrieve, Infer, Apply Cite an infectious disease...Ch. 18.7 - Prob. 2CCCh. 18.7 - Prob. 3CCCh. 18 - Prob. 1RCCh. 18 - Prob. 2RCCh. 18 - Prob. 3RCCh. 18 - Prob. 4RCCh. 18 - Prob. 5RCCh. 18 - Prob. 1ALCh. 18 - Prob. 2ALCh. 18 - You are developing a new vaccine for a pathogen....Ch. 18 - Prob. 4AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
Provide five advantages of Next Generation Sequencing? and explain each of these advantages.
arrow_forward
What other information do you need to know if your extracts can be used for NGS sequencing?
arrow_forward
Question:-
Define, compare, and contrast the utility of microarray and RNAseq while analyzing gene expression levels.
arrow_forward
what is the whole-genome shotgun sequencing? Also briefly explain its strategy to assemble the genome sequence.
arrow_forward
what is the main purpose of performing the bioinformatics analysis of 16s rRNA genes lab?
arrow_forward
To clone a bacterial lipase gene into the cloning vector pET28a, you know the full sequence of the gene to be cloned. While you are designing the experiments, which bioinformatics tool(s) you want to use? Suggest a roadmap for this study
arrow_forward
Write down all possible outcomes for template ATGCCTAAGTTTCCCTAT sequencing.
arrow_forward
Compare 2D polyacrylamide gel electrophoresis to LC-MS as a proteomics technique to identify differences between patients with a disease and controls without the disease.
arrow_forward
Design a oligonucleotide probe for provided gene sequence using all the guidelines for efficient probe designing.
ACAACCCCAAGCCTTCAACCACCCCCTTCCCCCAAATTAGAGATCGATCTCAAGAAGAAGAATGGGTTCCGTCTCTCGCTCTTCTTTGGATCAGAAGCTGGCCATGGCAAAGCGCTGCTCCCACGAGGGAGTTGTCGCGGGAGCAAAGGCGGCCGTGGTTGCAACTGTTGCCTCGGCCATTCCTACTTTGGCTAGCGTTAGGATGATCCCATGGGCGAGGTCCTTCCTTAATCCCGCAGCTCAGGCCCTCATCGTTTCATCAGCGGCGGGGGCGGCGTACTTCATAGTTGCGGACAAGAC
arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
8C - How to do genetic analysis; Author: Useful Genetics;https://www.youtube.com/watch?v=HIa7nPyGn4s;License: CC-BY