The type of gene library used and its reason for analyzing each of the following: a. The expression of a gene encoding amylase (a starch hydrolyzing enzyme) in seeds as they germinate. b. The sequence of the amylase gene in two different genetic strains of corn. Introduction: A collection of different cloned deoxyribonucleic acid (DNA) sequences from an organism are called as gene library. The DNA sequences are cloned into a vector for purification, storage, and analysis. There are usually two types of gene library, namely: genomic library and complementary DNA (cDNA) library, which depends on the source of DNA used.

Question

Want to see the full answer?

Answer 1

Question

Chapter 18.3, Problem 1R

Summary Introduction

To review:

The type of gene library used and its reason for analyzing each of the following:

a. The expression of a gene encoding amylase (a starch hydrolyzing enzyme) in seeds as they germinate.

b. The sequence of the amylase gene in two different genetic strains of corn.

Introduction:

A collection of different cloned deoxyribonucleic acid (DNA) sequences from an organism are called as gene library. The DNA sequences are cloned into a vector for purification, storage, and analysis. There are usually two types of gene library, namely: genomic library and complementary DNA (cDNA) library, which depends on the source of DNA used.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Amoebic keratitis is a rare eye infection associated with the use of soft contact lenses. The infection occurs when certain types of amoebas gain entry into the eye through the use of contaminated contact lenses. Medical researchers have used a restriction enzyme digest to characterize the type of amoeba found in patients with amoebic keratitis. These researchers extracted the mitochondrial DNA from infection-causing amoebas and digested, or cut, the DNA with a restriction enzyme. They found that, when visualized using DNA gel electrophoresis, the cut samples contained five bands of the following sizes: roughly 4,200 base pairs (bp), 5,500 bp, 6,500 bp, 9,300 bp, and 10,500 bp. To determine the prevalence of infection-causing amoebas in a certain region, researchers obtained samples from contact lens cases in a representative set of households. The researchers isolated the amoebas present in each sample, then used the protocol described above to view the DNA banding patterns of the…

In the cookbook analogy of the flow of genetic information, the cookbook corresponds to_____ and its location to the _____. One recipe corresponds to a _____, and the piece of paper where the recipe was copied is_____. The process of copying corresponds to _____. Cooking corresponds to the process of ____ and the kitchen to____. The food cooked would be synthesized _____. ***Please use the answer key option in the image below. Thank you!

Consider the problem of searching for genes in DNA sequences using Hor-spool’s algorithm. ADNA sequence is represented by a text on the alphabet {A, C, G, T}, and the gene or gene segment is the pattern. a. Construct the shift table for the following gene segment of your chromo-some 10: TCCTATTCTT b. Apply Horspool’s algorithm to locate the above pattern in the following DNA sequence: TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT