Human Biology (MindTap Course List)
11th Edition
ISBN: 9781305112100
Author: Cecie Starr, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21, Problem 2RQ
Summary Introduction
To name: One kind of mutation that produces an altered protein.
Introduction: Mutations are alterations in gene that code for a particular protein and can affect a single base pair or a segment of chromosome. Proteins are major macromolecules made of several amino acid micro molecules and have a wide array of functions.
Summary Introduction
To explain: What determines whether the altered protein will have beneficial, neutral, or harmful effects?
Introduction: Mutations are alterations in gene that code for a particular protein and can affect a single base pair or a segment of chromosome. Proteins are major macromolecules made of several amino acid micro molecules and have a wide array of functions.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
name one kind of mutation that produces an altered protein. what determines wether the altered protein will have beneficial, neutral or harmful affects?
Which type of mutation results in abnormal amino acid sequence?
What are the three possible effects on the cell (or organism) when a mutation occurs in DNA? Which ones are most common? Which one is rare?
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.arrow_forwardDescribe three types of mutationsarrow_forward• What causes mutation? Is it always harmful? • Does a simple change on DNA sequence affect the resulting protein? Explain briefly.arrow_forward
- What three different types of mutations involve changes in a single base, and what effect can each of them have on a coding sequence? Which type is the most common? Which type has the most severe effect on the function of the encoded protein?arrow_forwardWhat type of mutation is C c?arrow_forwardWhich mutation is lethal?arrow_forward
- Why do some genetic mutations lead to completely nonfunctional proteins while others do not affect the functioning of the resulting protein at all?arrow_forwardWhat are the four different point mutations? How can genetic mutation (genotype) alter protein structure (phenotype)?arrow_forwardA mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to 5’ACGTCATGCGATAGTGCGTAAACTA3’ Describe the effect of this mutation on the protein, and give the name of the type of mutation.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY