Human Biology (MindTap Course List)
11th Edition
ISBN: 9781305112100
Author: Cecie Starr, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 21, Problem 7SQ
Summary Introduction
Introduction: The process where the codons in the mRNA are translated with the help of ribosomes and tRNA to synthesize amino acid sequence is called protein synthesis; the amino acids are linked by a peptide bond to make the polypeptide chain that constitutes the proteins.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Speculate why the half-life of mRNA is short, while the half-lives of rRNA and tRNA are long.
What regulates the process of transcription and translation; compare and contrast these processes.
Which statement regarding UTRs is TRUE?
a) Transcription begins at the start of the 5' UTR
b) Translation begins at the start of the 5' UTR
c) The 5' and 3' UTRs are spliced from the mRNA transcript
d) The translation stop codon is found downstream of the 3' UTR
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Energy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomesarrow_forwardIn Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such space? b. How does it affect gene expression?arrow_forwardThese all relate to the translation of genetic information stored in mRNA into proteins and how chemical information in proteins imparts function to those molecules. Write a short essay that discusses the role of ribosomes in the process of translation as it relates to these concepts.arrow_forward
- Select the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.arrow_forwardAfter RNA polymerase binds to DNA, it begins making mRNA. What is the name of this process?arrow_forwardWhich statement BEST DESCRIBES the genetic code? A. There can only be one codon for multiple amino acids. B. There are only 10 different amino acids in proteins. C. More than one codon for a specific amino acid. D. The genetic is misinterpreted to have U instead of T.arrow_forward
- A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.arrow_forwardPlease choose the correct answer. Which of the following statements is NOT true about reverse transcription? a. A tRNA primer initiates reverse transcription. b. The second DNA strand begins at the polypurine tract. c. Reverse transcriptase degrades the copied RNA segment. d. Circularizing the DNA allows completion of the second DNA strand.arrow_forwardThe Kozak rules determine a. the choice of the start codon in complex eukaryotes. b. the choice of the start codon in bacteria. c. the site in the mRNA where translation ends. d. how fast the mRNA is translated.arrow_forward
- Imagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of these codons code for proline. The fact that more than one codon can code for the same amino acid is referred to as ___ a. the ambiguity of the genetic code b. the redundancy of the genetic code c. the randomness of the genetic code d. mutations in the genetic codearrow_forwardWhich is the mRNA molecule that would be transcribed from this DNA template: TGGCAAGTACGT answer choices A.) ACCGUUCAUGCA B.) UCCGUUCUUGCU C.) ACCGTTCATGCA D.) UGGCAAGUACGUarrow_forwardOnce translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY