General, Organic, and Biological Chemistry - 4th edition
General, Organic, and Biological Chemistry - 4th edition
4th Edition
ISBN: 9781259883989
Author: by Janice Smith
Publisher: McGraw-Hill Education
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 22.9, Problem 22.10PP
Interpretation Introduction

(a)

Interpretation:

The dipeptide molecule formed from the given DNA base sequence should be given.

Concept Introduction:

Genetic information is included in DNA and most of them code for a particular protein. Consecutive three base pairs represent a single amino acid. Genetic information coded in DNA, first transcribed in to mRNA sequence and using that mRNA molecule translate into an amino acid sequence which can be defined as a protein depending on the number of amino acids.

  General, Organic, and Biological Chemistry - 4th edition, Chapter 22.9, Problem 22.10PP

Interpretation Introduction

(b)

Interpretation:

The dipeptide sequence difference should be given when the point mutation is happen in the DNA sequence.

Concept Introduction:

Point mutations are DNA molecular level changes in the sequence. This includes insertions, deletions and substitutions. In given question, it only includes substitutions. Substitution point mutations whre the base pair sequence changes which means one base replace with the other base. This may cause to change the amino acid sequence of the peptide. But, there will be some occasions where the amino acid sequence does not change.

Blurred answer
Students have asked these similar questions
Consider the following sequence of DNA: 3 '–TTA CGG–5 '. a. What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?
a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA
If 27% of the nucleotides in a sample of DNA contain the base adenine (A), what are the percentages of bases T, G, and C?

Chapter 22 Solutions

General, Organic, and Biological Chemistry - 4th edition

Ch. 22.2 - Label each statement about the polynucleotide...Ch. 22.3 - Write the complementary strand for each of the...Ch. 22.4 - What is the sequence of a newly synthesized DNA...Ch. 22.6 - For each DNA segment: [1] What is the sequence of...Ch. 22.6 - Prob. 22.9PCh. 22.7 - What amino acid is coded for by each codon? GCC...Ch. 22.7 - What codons code for each amino acid? a. glycine...Ch. 22.7 - Drive the amino acid sequence that is coded for by...Ch. 22.7 - Write a possible mRNA sequence that codes for each...Ch. 22.7 - Considering the given sequence of nucleotides in...Ch. 22.8 - Prob. 22.14PCh. 22.8 - Prob. 22.8PPCh. 22.8 - Prob. 22.9PPCh. 22.9 - Prob. 22.10PPCh. 22.9 - Prob. 22.15PCh. 22.10 - Prob. 22.16PCh. 22 - Label each statement as pertaining to DNA, RNA, or...Ch. 22 - Label each statement as pertaining to DNA, RNA, or...Ch. 22 - Prob. 19PCh. 22 - (a) Give the name of each compound shown as a...Ch. 22 - Prob. 21PCh. 22 - Prob. 22PCh. 22 - Prob. 23PCh. 22 - Prob. 24PCh. 22 - Prob. 25PCh. 22 - Draw the structure of each of the following: a...Ch. 22 - Prob. 27PCh. 22 - Prob. 28PCh. 22 - Prob. 29PCh. 22 - Prob. 30PCh. 22 - Prob. 31PCh. 22 - Draw the structures of the two possible...Ch. 22 - Prob. 33PCh. 22 - Draw the structure of each dinucleotide and...Ch. 22 - Draw the deoxyribonucleotide TGA. Label the 5 and...Ch. 22 - Draw the ribonucleotide CGU. Label the 5 and 3...Ch. 22 - Prob. 37PCh. 22 - Describe in detail the DNA double helix with...Ch. 22 - Write the sequence of the complementary strand of...Ch. 22 - Prob. 40PCh. 22 - Prob. 41PCh. 22 - Prob. 42PCh. 22 - Prob. 43PCh. 22 - Prob. 44PCh. 22 - Prob. 45PCh. 22 - Figure 22.4 snows the hydrogen-bonding...Ch. 22 - Prob. 47PCh. 22 - Prob. 48PCh. 22 - Prob. 49PCh. 22 - Prob. 50PCh. 22 - What mRNA is transcribed from each DNA sequence in...Ch. 22 - Prob. 52PCh. 22 - For each DNA segment: [1] What is the sequence of...Ch. 22 - Prob. 54PCh. 22 - For each codon, give its anticodon and the amino...Ch. 22 - For each codon, give its anticodon and the amino...Ch. 22 - Fill in the missing information in the schematic...Ch. 22 - Fill in the missing information in the schematic...Ch. 22 - Derive the amino acid sequence that is coded for...Ch. 22 - Derive the amino acid sequence that is coded for...Ch. 22 - Write a possible mRNA sequence that codes for each...Ch. 22 - Prob. 62PCh. 22 - Prob. 63PCh. 22 - Prob. 64PCh. 22 - Prob. 65PCh. 22 - Prob. 66PCh. 22 - Consider the following mRNA sequence:...Ch. 22 - Consider the following mRNA sequence: 5-ACC UUA...Ch. 22 - Consider the following sequence of DNA: 3-TTA...Ch. 22 - Consider the following sequence of DNA: 3-ATA...Ch. 22 - Prob. 71PCh. 22 - Prob. 72PCh. 22 - Prob. 73PCh. 22 - Prob. 74PCh. 22 - Prob. 75PCh. 22 - Prob. 76PCh. 22 - Prob. 77PCh. 22 - Prob. 78PCh. 22 - Prob. 79PCh. 22 - Prob. 80PCh. 22 - Prob. 81PCh. 22 - Prob. 82PCh. 22 - Fill in the base, codon, anticodon, or amino acid...Ch. 22 - Fill in the base, codon, anticodon, or amino acid...Ch. 22 - Fill in the base, codon, anticodon, or amino acid...Ch. 22 - Prob. 86PCh. 22 - Prob. 87PCh. 22 - Prob. 88PCh. 22 - Prob. 89PCh. 22 - Prob. 90PCh. 22 - Prob. 91CPCh. 22 - Give a possible nucleotide sequence in the...
Knowledge Booster
Background pattern image
Chemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Organic And Biological Chemistry
Chemistry
ISBN:9781305081079
Author:STOKER, H. Stephen (howard Stephen)
Publisher:Cengage Learning,
Text book image
General, Organic, and Biological Chemistry
Chemistry
ISBN:9781285853918
Author:H. Stephen Stoker
Publisher:Cengage Learning
Text book image
Organic Chemistry
Chemistry
ISBN:9781305080485
Author:John E. McMurry
Publisher:Cengage Learning
Text book image
Chemistry for Today: General, Organic, and Bioche...
Chemistry
ISBN:9781305960060
Author:Spencer L. Seager, Michael R. Slabaugh, Maren S. Hansen
Publisher:Cengage Learning
Text book image
Introduction to General, Organic and Biochemistry
Chemistry
ISBN:9781285869759
Author:Frederick A. Bettelheim, William H. Brown, Mary K. Campbell, Shawn O. Farrell, Omar Torres
Publisher:Cengage Learning
Text book image
Introductory Chemistry: A Foundation
Chemistry
ISBN:9781337399425
Author:Steven S. Zumdahl, Donald J. DeCoste
Publisher:Cengage Learning
Nucleic acids - DNA and RNA structure; Author: MEDSimplified;https://www.youtube.com/watch?v=0lZRAShqft0;License: Standard YouTube License, CC-BY