Concept explainers
(a)
To identify: The DNA sequence for the given sequence that encodes peptides of vir-1 and vir-2.
Concept introduction: Protein molecules are the essential nutrients of the body. Proteins are synthesized in the ribosomes of the cell. Transcription is the process of the production of mRNA from the DNA molecules. mRNA sequences carry the information from one generation to another. Translation is the process of synthesizing protein molecules.
Given: AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT.
(b)
To determine: The amino acid sequence for the peptides of vir-1 and vir-2.
Concept introduction: Protein molecules are the essential nutrients of the body. Proteins are synthesized in the ribosomes of the cell. Transcription is the process of the production of mRNA from the DNA molecules. mRNA sequences carry the information from one generation to another. Translation is the process of synthesizing protein molecules.
Given: AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT.
(c)
To determine: The amino acid sequence for the peptides of vir-1 and vir-2 that are encoded by mutant viruses where T, at position 23, is replaced by G.
Concept introduction: The protein molecules are the essential nutrients of the body. Proteins are synthesized in the ribosomes of the cell. Transcription is the process of the production of mRNA from the DNA molecules. mRNA sequences carry the information from one generation to another. Translation is the process of synthesizing protein molecules.
Given: AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT.
Want to see the full answer?
Check out a sample textbook solutionChapter 27 Solutions
FUNDAMENTALS OF BIOCHEMISTRY-ACCESS
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON