Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 30, Problem 19P
Interpretation Introduction
Interpretation:
The structure of peptide chain termination complex needs to be studied.
Concept Introduction:
Amino acids are organic compounds containing amino as well as acidic groups. The general molecular formula of an amino acid is as follows:
Here, R refers to different group for different amino acids. If there is more than one amino group present in an amino acid, they are considered as basic amino acids and if there is more than one carboxylic group then they are considered as acidic amino acids.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
My PDB code: 3GRS
residue point: HIS467
mutation: LEU
Describe why this position in your protein is important and outline the effects the mutation will have on the 3D structure and the function of your protein. (up to 50 words)
Referring back to the quaternary level proteins, list and describe the modifications that can be made to a secondary proteins to make it a tertiary protein
Using protein leptins' primary, secondary, and tertiary structure, explain your understanding on their differences. If you happen to mutate (change) the amino acid(s), then write or draw its possible primary, secondary and tertiary structure. Explain and compare this to the original structure of this protein.
Chapter 30 Solutions
Biochemistry
Ch. 30 - Prob. 1PCh. 30 - Prob. 2PCh. 30 - The Second Genetic Code Review the evidence...Ch. 30 - Codon-Anticodon Recognition: Base-Pairing...Ch. 30 - Consequences of the Wobble Hypothesis Point out...Ch. 30 - Prob. 6PCh. 30 - Prob. 7PCh. 30 - Prob. 8PCh. 30 - Prob. 9PCh. 30 - The Consequences of Ribosome Complexity Eukaryotic...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Exploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled ‘Biological Assembly.� click “More Images.� and then scroll down to look at the Interactive Vic By moving your cursor over the image, you can rotate it to view it from any perspective. a. How are the ribosomal proteins represented in the image? b. How is the 16S rRNA portrayed? c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out? d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex?arrow_forwardAnswer for each 1, 2, 3, 4 and 5 labelled in the attached image: a)What is this molecule? b)What superfamily does it belong to? c)Which number points to the peptide binding domain? Thank you!arrow_forwardTyped explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'arrow_forward
- A small protein has a sequence ACNCKAAPMLCARYCAMLH. The structure of this single peptide is stabilized by the formation of two separate disulfide bonds, but the locations of those disulfide bonds are unknown. In order to determine the location, you purify this peptide and treat it with trypsin (cleaves peptide bond at long, positively-charged side chains). Tryptic digestion generated two peptides. Based on this result, determine the location of the –S-S– bonds. Show them in a diagram on the sequence by connecting the corresponding residues. Explain your reasoning.arrow_forwardSequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forwardAffinity chromatography You have created a fusion protein tagged with Glutathione-S-Transferase (GST). Your lab mate tells you that the affinity columns for this type of tagged protein are very similar to that of Histadine tagged proteins. Using the following elements set up a purification column and construct a protocol for an affinity purification using this tag. A large amount of glutathione is usually used to elute the tagged protein off the column. How might this work?arrow_forward
- Give typed full explanation Given the following sequence of RNA, propose the potential hairpin structure for this RNA. Indicate base pairing with a dotted line. 5’ -AGGACCCUUCGGGGUUCU-3’arrow_forwardPosttranslational modifications serve several purposes. Discuss and give examplesarrow_forwardReferring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′arrow_forward
- Problem: From the following information determine the amino acid sequence of a peptide. N-terminal Edman gives PTH-Alanine C terminal carboxypeptidase treatment, no observable reaction Trypsin cleavage gives three products Arg Peptide containing Ala, Lys Peptide containing Asp, Met, Phe, Pro Mild Chymotrypsin cleavage gives 2 peptides Peptide containing Asp, Pro Peptide containing Ala, Arg, Lys, Met, Phe CNBr cleavage gives 2 peptides Peptide containing Ala, Arg, Lys and homoserine Peptide containing Asp, Phe, Pro You must supply the answer as the 3-letter amino acid sequence from N-terminus to C-terminus in the form (you must use dashes, not spaces between the amino acids) Met-Thr-Glu-Trparrow_forwardTranslation work is an essential step for protein synthesis. In order for the protein to be synthesized what must be recognized first in translation? How does this important part in translation have an effect on the rest of the reaction? Please provide a valid argument. Be as detailed as possible.arrow_forwardGood hand written explanation Asap Briefly describe the 2-dimensional and 3-dimensional structure of tRNA . With diagram.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license