Determine which amino acid will be incorporated into the polypeptide product. And what will be relative abundances of these amino acids in the product. Concept Introduction: Amino acids are compounds containing amino as well as acidic group. The general molecular structure of an amino acid is as follows: NH 2 -CHR-COOH Here, R is different group for different amino acids. If there is more than one amino group present in an amino acid, they are considered as basic amino acids and if there is more than one carboxylic group then they are considered as acidic amino acids.

Question

Want to see the full answer?

Answer 1

Question

Chapter 30, Problem 2P

Interpretation Introduction

Interpretation:

Determine which amino acid will be incorporated into the polypeptide product. And what will be relative abundances of these amino acids in the product.

Concept Introduction:

Amino acids are compounds containing amino as well as acidic group. The general molecular structure of an amino acid is as follows:

NH2-CHR-COOH

Here, R is different group for different amino acids. If there is more than one amino group present in an amino acid, they are considered as basic amino acids and if there is more than one carboxylic group then they are considered as acidic amino acids.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find enough space to do so. Once a small ribosomal subunit has bound to an mRNA, it will scan along that mRNA in the 5' to 3' direction looking for a start codon at which to initiate translation. How does the small ribosomal subunit distinguish a start codon from any other AUG codon that simply codes for methionine in the middle of a coding sequence?

15. Cellular proteins are oftentimes post-translationally modified. Choose one of the following PTMs: N-linked glycosylation, phosphorylation, ubiquitination, or GPI-anchor. Clearly indicate your choice, then address the following: (a) How is the PTM attached to the protein of interest? At which amino acid residue(s)? What enzyme(s) is involved, if any? (b) Is the PTM relatively stable or highly dynamic? Explain. How does the PTM become detached from the protein of interest? What enzyme(s) is involved, if any? (c) What is the function of the PTM? Provide one specific example.

Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3