Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 30, Problem 3P
The Second Genetic Code Review the evidence establishing that aminoacyl-tRNA synthetases bridge the information gap between amino acids and codons. Indicate the various levels of specificity possessed by aminoacyl-tRNA synthetases that are essential for high-fidelity translation of messenger RNA molecules.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Explain whether the specificity of lysine incorporation by lysyl-tRNA synthetase depends on tRNA or lysine, how does it work ?
Determine whether this statement is true or false:
Aminoacyl-tRNA synthetase covalently links the amino acid to the 5’ end of the correct tRNA molecule.
Explain how nucleic acid information is translated into aminoacid sequence and define the role of aminoacyl tRNA synthetases in this process
Chapter 30 Solutions
Biochemistry
Ch. 30 - Prob. 1PCh. 30 - Prob. 2PCh. 30 - The Second Genetic Code Review the evidence...Ch. 30 - Codon-Anticodon Recognition: Base-Pairing...Ch. 30 - Consequences of the Wobble Hypothesis Point out...Ch. 30 - Prob. 6PCh. 30 - Prob. 7PCh. 30 - Prob. 8PCh. 30 - Prob. 9PCh. 30 - The Consequences of Ribosome Complexity Eukaryotic...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Aminoacyl-tRNA synthetases are the only component of gene expression that decodes the genetic code. Explain.arrow_forwardComment on the accuracy of the aminoacylation during the charging of tRNA to ensure the fidelity of the genetic code. Also, list out the consequences in the translation process if the poly-A tail of the mRNA tail is deleted.arrow_forwarda) Identify the current stage of the translation process shown in Figure 1 and name the anticodon sequence in tRNAb) State TWO immediate, main consequences when a stop codon reaches the E site.arrow_forward
- Transfer RNA molecules are quite large, given that the anticodon consists of only three nucleotides. What is the purpose of the rest of the tRNA molecule?arrow_forwardThe following DNA sequence has been determined from DNA isolated from a bit of prehistoric amber material. A corresponds to a complete transcriptional unit without entrance. Use the genetic code to predict the primary sequence of the polypeptide encoded by this preserved DNA. (show all work including relevant molecular intermediates, and provide detailed and appropriate labels)arrow_forwardFrom this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminusarrow_forward
- Explain the significance of the following statement: The functioning of the aminoacyl-tRNA synthetases is referred to as the second genetic code.arrow_forwardWhat is the role of aminoacyl-tRNA synthetase? The ability of aminoacyl-tRNA synthetases to recognize tRNAs has sometimes been called the “second genetic code.” Why has the function of this type of enzyme been described this way?arrow_forwardReferring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′arrow_forward
- Yet another class of suppressor mutations not described in the chapter are mutations in tRNA genesthat can suppress frameshift mutations. What wouldhave to be true about a tRNA that could suppress aframeshift mutation involving the insertion of a singlebase pair?arrow_forwardA normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)arrow_forwardCompare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural differences.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY