Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 30, Problem 6P
Interpretation Introduction
Interpretation:
The number of codons that might mutate to become nonsense codons through the single base change should be determined along with the identification of encoded amino acids.
Concept Introduction:
Amino acids are compounds containing amino as well as acidic group. The general molecular structure of an amino acid is as follows:
Here, R is different group for different amino acids. If there is more than one amino group present in an amino acid, they are considered as basic amino acids and if there is more than one carboxylic group then they are considered as acidic amino acids.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Correct! The Leu codon is changed to a nonsense codon by a single-base substitution How many different ways can the LEU codon be changed into the nonsense mutation? 362110
There are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What codons are used and with what frequency?
Mutations: The codon GGA encodes the amino acid glycine. Identify the type of mutation for each of the following changes (name both the type of mutation and what the new codon would produce):
GGA to GGG
GGA to UGA
GGA to GAGA
GGA to AGA
Chapter 30 Solutions
Biochemistry
Ch. 30 - Prob. 1PCh. 30 - Prob. 2PCh. 30 - The Second Genetic Code Review the evidence...Ch. 30 - Codon-Anticodon Recognition: Base-Pairing...Ch. 30 - Consequences of the Wobble Hypothesis Point out...Ch. 30 - Prob. 6PCh. 30 - Prob. 7PCh. 30 - Prob. 8PCh. 30 - Prob. 9PCh. 30 - The Consequences of Ribosome Complexity Eukaryotic...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- 5’-CCTAGACCATAACAT-3’ What happens to the amino acid sequence above as a result of each of the following mutations in the DNA: Substitution of A with T at position 4? Addition of T between positions 8 and 9? Substitution of A with T at position 11? Deletion of A at position 12? Substitution of C with T at position 7? State the type of mutation for each of the base changes indicated.arrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype 1)What is the codon usage bias?arrow_forward2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find enough space to do so. Once a small ribosomal subunit has bound to an mRNA, it will scan along that mRNA in the 5' to 3' direction looking for a start codon at which to initiate translation. How does the small ribosomal subunit distinguish a start codon from any other AUG codon that simply codes for methionine in the middle of a coding sequence?arrow_forward
- Codons in the set CUU, CUC, CUA, and CUG all code for the amino acid leucine. In this set, the first and second bases are identical; the identity of the third base is irrelevant. For what other sets of codons is the third base also irrelevant? For what amino acid(s) does each set code?arrow_forwardThe genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forwardCodon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.arrow_forward
- Consequences of the Wobble Hypothesis Point out why Cricks wobble hypothesis would allow fewer than 61 anticodons to be used to translate the 61 sense codons. How might wobble tend to accelerate the rate of translation?arrow_forwardWhat is the start codon? What are the stop codons? Do any of them code for amino acids?arrow_forwardThe wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids? A. Leucine B. Methionine C. Serinearrow_forward
- mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’arrow_forwardWith in vitro translation of an RNA into a polypep-tide chain, the translation can begin anywhere along the RNA molecule. A synthetic RNA mole-cule has the sequence 5'-CGCUUACCACAUGUCGCGAAC-3'. How many reading frames are possible if this molecule is translated in vitro? How many reading frames are possible if this molecule is translated in vivo, in which translation starts with the codon AUG?arrow_forwardATTTGAGCC- OriginalATTGAGCC - Mutated The example above is an example of a Nonsense Deletion- Substitution Insertion- Frameshift Deletion -Frameshiftarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY