Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 6, Problem 18P
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book.
Consider the following peptide sequences:
EANQIDEMLYNVQCS LTTLE DTVPW
LG VHLDITVPL SWTWTLYVKL
QQNWGGLWILTLVWFLM CNMKHGDSQCDERTYP YTREQSDGHIPKMNCDS
AGPFGPDGPTIGPK
Which of the preceding sequences would be likely to be found in each of the following:
- A parallel β-sheet
- An antiparallel β -sheet
- A tropocollagen molecule
- The helical portions of a protein found in your hair
Expert Solution & Answer
Trending nowThis is a popular solution!
Chapter 6 Solutions
Biochemistry
Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...
Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...Ch. 6 - Answers to all problems are at the end of this...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Preparing cDNA Libraries from Different Cells Describe an experimental protocol for the preparation of to cDNA libraries, one from anaerobically grown yeast cells and the second from aerobically grown yeast cell.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Identify Proteins Using BLAST Searches of Peptide Fragment Sequences Go to the National Center for Biotechnology Information Web site at httlp:llhwww.ncbi.nlm.niih.goyl. From the menu (if Popular Resources on the right-hand side, click on “BLAST. Under the Basic BLAST heading on the new page that comes up, dick on protein blast. lit the Enter Query Sequence box at the top of the page that comes up, enter the following sequence: NQMMK.SR.N- LTKDRCKP. Confirm that the database under ChoOsC Search Set us set (111 nr (nonredundant protein Sequences), then click the BLAST button at the bottom (if the page td see the results of your search. Next, enter this sequence from a different protein: SLQTASAPDVYAlGfcCA. Identify the protein from which this sequence was derived.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Deducing DNA Sequence from Sanger Sequencing Results The output of an automated DNA sequence determination by the Sanger dideoxy chain termination method, performed as illustrated in Figure 11.3, is disp1ayed at right. What is the sequence of the original oligonucleotide?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. CRISPR/Cas9: Design of a gRNA to Target the Human PVALB Gene The human PVALB gene, which encodes the Ca2+-binding protein parvalbumin, can be Targeted by CRISPR/Cas9, at the protospacer sequence - ATGCAGGAGGGTGGCGAGAGGGGCCGAGAT- followed by a -TGG-PAM trinucleotide. Give the sequence of the spacer region of a gRNA that will target the complementary DNA strand at this site. Include at the 3'-end of your gRNA sequence a region that will form a stem-loop structure with a 5'-AGCAUAGCUGUAAAAC- sequence downstream in the gRNA to create the dsRNA-binding site for Cas9.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Solving the Sequence of an Oligopeptide From Sequence Analysis Data Amino acid analysis of a decapeptide revealed the presence of the following products: The following facts were observed: Neither car boxy peptidase A nor B treatment of the- decapeptide had any effect. Trypsin treatment yielded two tetrapcptides and free Lys. Clostripain treatment yielded a tetrapcptide and a hexapeptidc. Cyanogen bromide treatment yielded an octapeptide and a dipeptide of sequence NP (using the one-letter codes). Chymotrypsin treatment yielded two tripeptides and a telrapeptide. The N-terminal chymotryptic peptide had a net charge of — 1 at neutral pi I and a net charge of —3 al pH 12. One cycle of Ed man degradation gave the PTH derivative What is the ammo acid sequence of this decapeptide?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Predicting a Sanger Sequencing Pattern The oligonucleotide d-AGATGCCTGACT as subjected to sequencing by Sanger’s dideoxy method, using fluorescent-tagged dideoxynucleotides and capillary electrophoresis, essentially as shown in Figure 11.3. Draw a diagram of the gel-banding pattern within the capillary.arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Oligonucleotide Structure Draw the chemical structure of pACG.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence (53)ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Abundance of the Different Bases in the Human Genome Results on the human genome published in Science (Science 291 :1304—1350 [2001]) indicate that the haploid human genome consists of 2.91 gigabase pairs (2.91 X ]09 base pairs} and that 27% of the bases in human DNA are A. Calculate the number of A. T, G, and C residues in a typical human cell.arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Interpreting Kinetics Experiments from Graphical Patterns The following graphical patterns obtained from kinetic experiments have several possible interpretations depending on the nature of the experiment and the variables being plotted. Give at least two possibilities for each.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Sequence Relationship Between an Antisense RNA Strand and Its Template DNA Strand The DNA strand that is complementary to the template strand copied by RNA polymerase during transcription has a nucleotide sequence identical to that of the RNA being synthesized (except T residues are found in the DNA strand at sites where U residues occur in the RNA). An RNA transcribed from this nontem-plate DNA strand would be complementary to the mRNA synthesized by RNA polymerase. Such an RNA is called antisense RNA because its base sequence is complementary to the “sense mRNA. One strategy to thwart the deleterious effects of genes activated in disease slates (such as cancer) is to generate antisense RNAs in affected cells. These antisense RNAs would form double-stranded hybrids with mRNAs transcribed from the activated genes and prevent their translation into protein. Suppose transcription of a cancer-activated gene yielded an mRNA whose sequence included the segment 5’-UACGUCUAAGCUGA. What is the corresponding nucleotide sequence (5’ The template strand in a DNA duplex that might be introduced into these cells so that an untisense RNA could be transcribed from it?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Cells as Steady-State Systems Describe what is meant by the phrase "cells tire steady-state systems." (Section 1.4)arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY